Закрыть

Сп 11 104 97 часть 1: NormaCS ~ Ответы экспертов ~ Область применения сводов правил производства инженерно-геодезических изысканий

Содержание

Инженерно-геодезические изыскания для строительства СП 11-104-97

4.4. В результате выполнения инженерно-геодезических изысканий, включающих

геодезические, топографические, аэрофотосъемочные, стереофотограмметрические,

инженерно-гидрографические, трассировочные работы, геодезические стационарные

наблюдения, кадастровые и другие специальные работы и исследования, а также

геодезические работы в процессе строительства, эксплуатации и ликвидации

предприятий, зданий и сооружений, обеспечиваются:

развитие опорных геодезических сетей, включая геодезические сети специального

назначения для строительства;

обновление топографических и инженерно-топографических планов;

создание инженерно-топографических планов (в графической, цифровой,

фотографической и иных формах), профилей и других топографо-геодезических

материалов и данных, предназначенных для обоснования проектной подготовки

строительства (градостроительной документации, обоснований инвестиций в

строительство, проектов и рабочей документации);

создание и ведение геоинформационных систем (ГИС) поселений и предприятий,

государственных кадастров (градостроительного в соответствии с требованиями СНиП

14-01-96, земельного и др. );

создание и обновление тематических карт, планов и атласов специального

назначения (в графической, цифровой, фотографической и иных формах);

создание топографической основы и получение геодезических данных для

выполнения других видов инженерных изысканий, в том числе при геотехническом

контроле, обследовании грунтов оснований фундаментов зданий и сооружений,

разработке мероприятий по инженерной защите и локальном мониторинге территорий,

авторском надзоре за использованием изыскательской продукции в процессе

строительства;

формирование и ведение государственных территориальных фондов материалов

инженерных изысканий органов исполнительной власти субъектов Российской

Федерации или местного самоуправления и государственного ведомственного фонда

материалов комплексных инженерных изысканий (в том числе инженерно-

геодезических изысканий) Федерального органа исполнительной власти по

строительству (Госстроя России), а также фондов других министерств и ведомств;

проведение операций с недвижимостью, управление территориями.

4.5. Формирование, использование и распоряжение государственными

территориальными фондами материалов инженерных изысканий осуществляют в

установленном порядке органы архитектуры и градостроительства исполнительной

власти субъектов Российской Федерации или местного самоуправления (если это право

им делегировано), а государственным ведомственным фондом материалов

комплексных инженерных изысканий - Госстрой России.

4.6. Инженерно-геодезические изыскания для строительства выполняются как

самостоятельный вид инженерных изысканий и в комплексе с другими видами

инженерных изысканий (изыскательских работ и исследований), в том числе

инженерно-геологическими, инженерно-гидрометеорологическими и инженерно-

экологическими изысканиями, а также изысканиями грунтовых строительных

материалов и источников водоснабжения на базе подземных вод.

4.7. Инженерно-геодезические изыскания следует выполнять, как правило, в три

этапа: подготовительный, полевой и камеральный.

В подготовительном этапе должны быть выполнены:

оформление соответствующих лицензий на право производства инженерных

изысканий для строительства;

получение технического задания и подготовка договорной (контрактной)

документации;

Нормативная документация

Бланки технических заданий 

  • Инженерно-геологические изыскания (Cкачать)
  • Инженерно-геодезические изыскания (Cкачать)
  • Инженерно-экологические изыскания (Cкачать)

Нормативные документы 

СНиПы

  • СНиП 2.01.07-85 Нагрузки и воздействия (Скачать)
  • СНиП 2.01.15-90 Инженерная защита территорий, зданий и сооружений от опасных геологических процессов (Скачать)
  • Пособие по составлению и оформлению документации инженерных изыскания для строительства (Скачать)

ГОСТы

  • ГОСТ 19912-2001 Методы полевых испытаний статическим и динамическим зондированием (Скачать)
  • ГОСТ 21. 101-97 Требования к документации (Скачать)
  • ГОСТ 21.302-96 Условные графические обозначения (Скачать)
  • ГОСТ 25100-95 Грунты. Классификация (Скачать)
  • ГОСТ Р 53788-2013 Здания и сооружения. Правила обследования и мониторинга технического состояния (Скачать)

СП

  • СП 11-102-97 Инженерно-экологические изыскания для строительства (Скачать)
  • СП 11-104-97-1 Инженерно-геодезические изыскания для строительства. Часть 1 (Скачать)
  • СП 11-104-97-2 Инженерно-геодезические изыскания для строительства. Часть 2 (Скачать)
  • СП 11-105-97-1 Инженерно-геологические изыскания для строительства. Часть 1 (Скачать)
  • СП 11-105-97-2 Инженерно-геологические изыскания для строительства. Часть 2 (Скачать)
  • СП 11-105-97-3 Инженерно-геологические изыскания для строительства. Часть 3 (Скачать)
  • СП 11-105-97-4 Инженерно-геологические изыскания для строительства. Часть 4 (Скачать)
  • СП 11-105-97-5 Инженерно-геологические изыскания для строительства. Часть 5 (Скачать)
  • СП 50-102-2003 Проектирование и устройство свайных фундаментов (Скачать)
  • СП 13-102-2003 Правила обследования несущих строительных конструкций зданий и сооружений (Скачать)

Прочее

  • Инструкция по инженерно-геологическим и геоэкологическим изысканиям в г. Москве (Скачать)
  • Справочник базовых цен (Скачать)

Нормативный центр Саратова - Главная

Нормативный центр «ЭнергоСтройСвязь» уже пятнадцать лет на рынке нормативно-технической документации. Мы  работаем с организациями по договорам и заявкам, осуществляя поставку нормативных документов для лабораторий по экологии, метрологии,  гражданской обороне, пожарной безопасности, энергетике и теплоэнергетике, связи, строительству, нефти, газу, охране труда от их разработчиков - издательств, авторов, научных организаций различного уровня.

Мы  являемся официальными представителями и дилерами в г. Саратове более 30-ти издательств и организаций-разработчиков. В нашей работе приоритетом являются официальные издания, ведется учет  выхода новых норм, правил, пособий и изменений к ним. Мы распространяем знаки безопасности согласно ГОСТа на пленке и пластике, удостоверения, плакаты и журналы по охране труда, энергетике, пожарной безопасности, строительству и т.д. (см. раздел Тематики).

Одним из достоинств нашего центра является сотрудничество с Федеральным центром по ценообразованию в строительстве (ФГУ ФЦЦС), участие в регулярных семинарах в Москве  позволяет нам быть в курсе всех последних событий в сфере ценообразования, а также распространять официальные сметные нормативы по ценам разработчика.

Второе направление в нашей работе является деятельность по распространению и сопровождению  программного комплекса «РИК» для выпуска сметной документации на объекты строительства.

Нормативный центр - единственныей дилер ПК РИК в Саратовском регионе с 2003 года. Благодаря внимательному отношению к проблемам  и информационно-консультативным услугам  по работе с ПК мы заслужили уважение  и признательность наших пользователей.

В результате нашими услугами уже воспользовались более 1000 организаций, 50% из которых наши постоянные клиенты на договорной основе - это институты «Саратовгражданпроект», «Проектмостореконструкция», «Саратовжелдорпроект», «Волгопроектстроймост»,  «Стройпроект», «Гипродорнии», «СГТУ», а также Главгосэкспертиза, ОАО «Волгомост», Управление по эксплуатации  и ремонту зданий и сооружений  Правительства области,  Пенсионный фонд по Саратовской области, филиалы ОАО «Волжская ТГК» (теперь ПАО "Т-Плюс"), филиалы и подразделения ОАО "РЖД" и др.

У нас взаимовыгодное сотрудничество с такими контролирующими организациями как Госэнергонадзор, Госстройнадзор, Госгортехнадзор и инспекция по труду.

Ждем вас у себя - мы поможем избежать вам конфликтов с контролирующими органами, сэкономить ваше время и деньги на поиск и приобретение необходимой нормативно-технической литературы, которая будет являться для многих в работе не просто хорошим помощником, но и орудием труда. Ну а сметчики всегда желанные клиенты для нас. Надеемся на взаимовыгодное сотрудничество!

 

Руководитель Нормативного центра «ЭнергоСтройСвязь»

ИП Фролова Ольга Михайловна

 

Справочники, СНИПы, сборники базовых цен по геодезии

СП 11-109-98 Изыскания грунтовых строительных материалов

01 января 1991 г.

Скачать Количество скачиваний: 1071

СП 11-108-98 Изыскания источников водоснабжения на базе подземных вод

14 октября 1997 г.

Скачать Количество скачиваний: 855

СП 11-102-97 Инженерно-экологические изыскания для строительства

15 августа 1997 г.

Скачать Количество скачиваний: 2068

СП 11-103-97 Инженерно-гидрометеорологические изыскания для строительства

15 августа 1997 г.

Скачать Количество скачиваний: 2026

СП 11-105-97 Инженерно-геологические изыскания для строительства. Часть 6. Правила производства геофизических исследований

2004 г.

Скачать Количество скачиваний: 856

СП 11-105-97 Инженерно-геологические изыскания для строительства. Часть 5. Правила производства работ в районах с особыми природно-техногенными условиями

10 января 2003 г.

Скачать Количество скачиваний: 993

СП 11-105-97 Инженерно-геологические изыскания для строительства. Часть 4. Правила производства работ в районах распространения многолетнемерзлых грунтов

01 января 2000 г.

Скачать Количество скачиваний: 927

СП 11-105-97. Инженерно-геологические изыскания для строительства. Часть 3. Правила производства работ в районах распространения специфических грунтов

01 июля 2000 г.

Скачать Количество скачиваний: 864

СП 11-105-97 Инженерно-геологические изыскания для строительства. Часть 2. Правила производства работ в районах развития опасных геологических и инженерно-геологических процессов

01 января 2001 г.

Скачать Количество скачиваний: 804

СП 11-105-97 Инженерно-геологические изыскания для строительства. Часть 1. Общие правила производства работ.

01 марта 1998 г.

Скачать Количество скачиваний: 866

СП 11-104-97 Инженерно-геодезические изыскания для строительства

01 января 1998 г.

Скачать Количество скачиваний: 820

СП 11-104-97 Инженерно-геодезические изыскания для строительства. Часть 2. Выполнение съемки подземных коммуникаций при инженерно-геодезических изысканиях для строительства

01 января 2002 г.

Скачать Количество скачиваний: 862

СП 11-104-97 Инженерно-геодезические изыскания для строительства. Часть 3. Инженерно-гидрографические работы при инженерных изысканиях для строительства

01 мая 2004 г.

Скачать Количество скачиваний: 942

СП 47.13330.2012 "СНиП 11-02-96 "Инженерные изыскания для строительства. Основные положения"

01 июля 2013 г.

Скачать Количество скачиваний: 839

Приказ Минрегиона РФ от 30.12.2009 N 624 (ред. от 14.11.2011)

30 декабря 2009 г.

Скачать Количество скачиваний: 820

Земельный кодекс РФ от 25.10.2001г. № 136-ФЗ

Скачать Количество скачиваний: 919

Водный кодекс РФ от 03.06.2006 № 74-ФЗ

Скачать Количество скачиваний: 865

Справочник базовых цен на инженерные изыскания для строительства. Инженерно-гидрографические работы. Инженерно-гидрометеорологические изыскания на реках

01 января 2001 г.

Скачать Количество скачиваний: 945

Сборник цен на изыскательские работы для капитального строительства. Раздел "Геофизические изыскания"

16 июля 1981 г.

Скачать Количество скачиваний: 970

Справочник базовых цен на инженерно-геологические и инженерно-экологические изыскания для строительства

01 января 1991 г.

Скачать Количество скачиваний: 912

Справочник базовых цен по инженерно геодезическим изысканиям

24 мая 2006 г.

Скачать Количество скачиваний: 707

Документация исполнительная геодезическая

01 июля 2002 г.

Скачать Количество скачиваний: 694

Геодезические работы в строительстве СНиП 3.01.03-84

01 января 2013 г.

Скачать Количество скачиваний: 751

Градостроительный кодекс Российской Федерации от 29 декабря 2004 г. N 190-ФЗ

Скачать Количество скачиваний: 677

СПАРК — Проверка контрагента, узнать сведения об организации по ИНН, анализ рынка в системе СПАРК-Интерфакс

1 Москва 117,17 83 308 348,00 32,65 %
2 Санкт-Петербург 100,19 28 008 200,38 10,98 %
3 Московская область 82,03 16 931 090,17 6,64 %
4 Тюменская область 156,35 12 541 058,84 4,92 %
5 Свердловская область 63,43 8 012 295,22 3,14 %
6 Краснодарский край 57,85 6 731 409,44 2,64 %
7 Республика Татарстан 54,55 5 859 800,37 2,30 %
8 Нижегородская область 71,60 5 818 635,50 2,28 %
9 Самарская область 55,52 5 420 623,91 2,12 %
10 Башкортостан (Республика) 59,41 4 625 643,39 1,81 %
11 Красноярский край 67,87 4 492 977,44 1,76 %
12 Новосибирская область 40,34 4 136 285,51 1,62 %
13 Ростовская область 46,46 3 649 633,11 1,43 %
14 Челябинская область 45,55 3 608 198,83 1,41 %
15 Кемеровская область 76,44 3 066 762,26 1,20 %
16 Пермский край 47,36 2 927 621,48 1,15 %
17 Иркутская область 51,61 2 708 025,93 1,06 %
18 Приморский край 43,46 2 438 220,20 0,96 %
19 Ленинградская область 69,63 2 342 025,20 0,92 %
20 Воронежская область 46,21 2 240 735,75 0,88 %
21 Белгородская область 59,67 1 959 018,94 0,77 %
22 Волгоградская область 46,41 1 728 123,43 0,68 %
23 Калужская область 72,17 1 679 336,89 0,66 %
24 Хабаровский край 46,31 1 668 602,87 0,65 %
25 Вологодская область 45,59 1 588 875,76 0,62 %
26 Удмуртская Республика 44,58 1 560 897,34 0,61 %
27 Оренбургская область 49,41 1 535 416,96 0,60 %
28 Калининградская область 36,50 1 511 722,97 0,59 %
29 Тульская область 48,82 1 495 358,69 0,59 %
30 Липецкая область 70,97 1 373 523,88 0,54 %
31 Алтайский край 28,97 1 324 784,31 0,52 %
32 Томская область 49,53 1 319 576,32 0,52 %
33 Ставропольский край 35,18 1 278 412,97 0,50 %
34 Коми (Республика) 77,14 1 253 386,66 0,49 %
35 Республика Крым 38,10 1 220 190,58 0,48 %
36 Саратовская область 28,77 1 205 026,61 0,47 %
37 Омская область 29,27 1 153 657,33 0,45 %
38 Ярославская область 30,32 1 093 081,87 0,43 %
39 Владимирская область 37,50 1 078 890,82 0,42 %
40 Брянская область 58,36 1 023 286,38 0,40 %
41 Саха (Республика) (Якутия) 44,50 1 017 825,00 0,40 %
42 Тверская область 31,40 940 307,02 0,37 %
43 Рязанская область 33,66 872 687,35 0,34 %
44 Архангельская область 38,32 784 427,21 0,31 %
45 Смоленская область 29,99 775 360,51 0,30 %
46 Мурманская область 52,03 749 981,70 0,29 %
47 Курская область 38,89 727 155,83 0,29 %
48 Ивановская область 26,40 724 104,78 0,28 %
49 Тамбовская область 46,13 701 052,74 0,27 %
50 Пензенская область 29,44 664 270,53 0,26 %
51 Ульяновская область 26,77 657 477,81 0,26 %
52 Кировская область 21,92 641 648,70 0,25 %
53 Бурятия (Республика) 32,92 616 384,12 0,24 %
54 Астраханская область 41,56 582 777,29 0,23 %
55 Чувашская Республика-Чувашия 26,50 570 669,87 0,22 %
56 Сахалинская область 38,50 548 133,53 0,21 %
57 Амурская область 34,50 477 541,08 0,19 %
58 Чеченская Республика 42,29 428 684,52 0,17 %
59 Дагестан (Республика) 13,37 408 466,26 0,16 %
60 Марий Эл (Республика) 34,76 403 643,53 0,16 %
61 Новгородская область 32,98 390 179,71 0,15 %
62 Мордовия (Республика) 31,24 388 523,27 0,15 %
63 Карелия (Республика) 19,61 378 578,41 0,15 %
64 Камчатский край 38,87 375 604,64 0,15 %
65 Орловская область 30,03 365 830,98 0,14 %
66 Магаданская область 84,64 327 236,81 0,13 %
67 Курганская область 26,45 324 114,97 0,13 %
68 Забайкальский край 24,70 318 786,96 0,12 %
69 Псковская область 23,28 309 960,02 0,12 %
70 Костромская область 20,21 279 047,82 0,11 %
71 Хакасия (Республика) 33,41 264 968,68 0,10 %
72 Северная Осетия-Алания (Республика) 21,10 190 604,85 0,07 %
73 Карачаево-Черкесская Республика 24,18 152 957,98 0,06 %
74 Кабардино-Балкарская Республика 12,91 144 091,02 0,06 %
75 Алтай (Республика) 28,90 143 327,34 0,06 %
76 Адыгея (Республика) (Адыгея) 21,32 139 138,99 0,05 %
77 Севастополь 11,99 128 932,27 0,05 %
78 Чукотский автономный округ 119,30 120 488,23 0,05 %
79 Ингушетия (Республика) 11,23 59 765,11 0,02 %
80 Тыва (Республика) 13,20 46 842,24 0,02 %
81 Еврейская автономная область 17,08 43 070,52 0,02 %
82 Калмыкия (Республика) 10,26 36 315,48 0,01 %

11 Кодекс США § 104 - Корректировка сумм в долларах | Кодекс США | Закон США

Исторические и редакционные заметки

законодательные акты

Раздел 104 представляет собой компромисс между законопроектом Палаты представителей и поправкой Сената в отношении корректировки долларовых сумм в заголовке 11. Поправка Палаты представителей уполномочивает Судебную конференцию Соединенных Штатов передавать рекомендацию по единообразному проценту корректировки для каждого доллара. сумма в заголовке 11 и 28 USC1930 г. Конгрессу и Президенту до 1 мая 1985 г. и до 1 мая каждого шестого года после этого. Требование законопроекта Палаты представителей о том, что каждая такая рекомендация должна основываться только на любом изменении повышения стоимости жизни в течение периода, непосредственно предшествующего рекомендации, удалено.

доклад сената нет. 95–989

Этот раздел требует, чтобы директор административного управления судов США отчитывался перед Конгрессом и президентом до 1 октября 1985 г. и до 1 мая каждые 6 лет после этого с рекомендациями по корректировке сумм в долларах, указанными в этом заголовке.Комитет считает, что регулярная корректировка сумм в долларах Директором сэкономит время Конгресса и в то же время обеспечит сохранение относительных долларовых сумм, использованных в счете. Изменения стоимости жизни должны быть значительным, но не обязательно единственным фактором, учитываемым Директором. Тот факт, что произошел рост стоимости жизни, не обязательно означает, что корректировка долларовых сумм будет необходима или оправдана.

дом отчет нет. 95–595

Этот раздел требует, чтобы Судебная конференция сообщала Конгрессу каждые четыре года после даты вступления в силу Кодекса о банкротстве любых изменений, которые произошли в стоимости жизни в течение предшествующих четырех лет, и соответствующих корректировок долларовых сумм в законопроекте. .Суммы в долларах указаны в основном в разделе об освобождении от уплаты налогов (11 USC 522), приоритете заработной платы (11 USC 507) и праве на участие в главе 13 (11 USC 109). Этот раздел требует, чтобы Конференция рекомендовала единообразные процентные изменения этих сумм, основанные исключительно на изменениях стоимости жизни. Сумма в долларах в законопроекте не изменится в соответствии с этой рекомендацией без вето Конгресса. Вместо этого Конгресс должен принять позитивные меры, приняв закон, вносящий поправки в соответствующий раздел, если он желает осуществить это изменение.

Если Судебная конференция имеет рекомендации по политике относительно соответствующих долларовых сумм в кодексе о банкротстве, основанные не на соображениях стоимости жизни, есть адекватные каналы, по которым она может сообщать свои взгляды. Этот раздел предназначен исключительно для служебной функции по поддержанию долларовых сумм в коде на довольно постоянных реальных долларовых уровнях.

Редакционные примечания

Поправки

2008 — Pub. L. 110–406, переименованный в п.(b) (1) как (a), пп. (A) и (B) подп. (b) (1) как пп. (1) и (2), соответственно, п. (а) и пар. (2) и (3) подп. (б) в качестве подзапросов. (b) и (c), соответственно, заменили «подраздел (a)» на «параграф (1)» в подразделе. (c) и вычеркнуты бывшие подст. (a) который гласит следующее: «Конференция судей Соединенных Штатов передает Конгрессу и Президенту до 1 мая 1985 г. и до 1 мая каждого шестого года после 1 мая 1985 г. рекомендацию по униформе. процентная корректировка каждой суммы в долларах в этом заголовке и в разделе 1930 заголовка 28.”

2005 — Подст. (б) (1). Паб. L. 109–8, §1202 (1) - (4), во вводных положениях добавлены «101 (19A)» после «101 (18)», «522 (f) (3) и 522 (f)». (4) »после« 522 (d) »и« 541 (b), 547 (c) (9) »после« 523 (a) (2) (C) »и заменили« 1322 (d ), 1325 (b) и 1326 (b) (3) этого заголовка и раздел 1409 (b) заголовка 28 »для« и 1325 (b) (3) ».

Паб. L. 109–8, §1002, добавлено «101 (18)» после «101 (3)» во вводных положениях.

Паб. L. 109–8, §432 (c), добавлено «101 (51D)» после «101 (3)» во вводных положениях.

Паб. L. 109–8, §322 (b), добавлены «522 (p), 522 (q)» после «522 (n)» во вводных положениях.

Паб. L. 109–8, §226 (b), добавлен «101 (3)» после «разделов» во вводных положениях.

Паб. L. 109–8, §224 (e) (2), во вводных положениях добавлено «522 (n)» после «522 (d)».

Паб. L. 109–8, §102 (j), заменены «523 (a) (2) (C), 707 (b) и 1325 (b) (3)» на «и 523 (a) (2) ( В) »во вводных положениях.

Подсек. (Би 2). Паб. L. 109–8, §1202 (1) - (3), (5), добавлены «101 (19A)» после «101 (18)», «522 (f) (3) и 522 (f)». (4) »после« 522 (d) »и« 541 (b), 547 (c) (9) »после« 523 (a) (2) (C) »и заменили« 1322 (d ), 1325 (b) и 1326 (b) (3) этого заголовка и раздел 1409 (b) заголовка 28 »для« и 1325 (b) (3) этого заголовка ».

Паб. L. 109–8, §1002, добавлено «101 (18)» после «101 (3)».

Паб. L. 109–8, §432 (c), добавлен «101 (51D)» после «101 (3)».

Паб. L. 109–8, §322 (b), добавлено «522 (p), 522 (q)» после «522 (n),».

Паб. L. 109–8, §226 (b), добавлен «101 (3)» после «разделов».

Паб. L. 109–8, §224 (e) (2), добавлено «522 (n)» после «522 (d)».

Паб. L. 109–8, §102 (j), заменены «523 (a) (2) (C), 707 (b) и 1325 (b) (3)» на «и 523 (a) (2) ( В) ».

1994 — Pub. L. 103–394 обозначил существующие положения как подст. (а) и добавлен подст. (б).

Обязательства и связанные с ними дочерние компании

Дата вступления в силу поправки 2005 г.

Поправка, внесенная Pub. L. 109–8 вступает в силу через 180 дней после 20 апреля 2005 г. с поправками, внесенными в разделы 102 (j), 224 (e) (2), 226 (b), 432 (c), 1002 и 1202 Pub. L. 109–8 не применяется в отношении дел, возбужденных под этим заголовком до такой даты вступления в силу, за исключением случаев, когда предусмотрено иное, и поправки, внесенные разделом 322 (b) Pub.L. 109–8, применимые в отношении дел, возбужденных под этим заголовком 20 апреля 2005 г. или после этой даты, см. Раздел 1501 Pub. L. 109–8, изложенный в виде примечания к разделу 101 этого заголовка.

Судебный регламент и судебные документы

Корректировка сумм в долларах

Уведомлением от 5 февраля 2019 г., 84 F.R. 3488 Судебная конференция Соединенных Штатов скорректировала долларовые суммы в положениях, указанных в подст. (a) настоящего раздела, вступившего в силу с 1 апреля 2019 г., следующим образом:

Раздел 1409 (b) - доверительный управляющий может начать производство по делу или связанное с ним, чтобы взыскать

.

(1) - денежный приговор или имущество стоимостью менее

1300 долларов США

$ 1 375

(2) - потребительский долг менее

$ 19 250

$ 20 450

(3) - непотребительский долг перед лицом, не являющимся инсайдером, менее

$ 12 850

$ 13 650

1 Новые (скорректированные) суммы в долларах отражают 6. Увеличение на 218 процентов, округленное до ближайших 25 долларов.

2 Так в оригинале. Наверное, следует указать «каждый раз, когда он появляется».

Раздел 101 (3) - определение лица, которому оказывается помощь

$ 192 450

204 425 долларов.

Раздел 101 (18) - определение семейного фермера

4 153 150 $ (каждый раз, когда появляется)

$ 4 411 400 (каждый раз, когда он появляется)

Раздел 101 (19A) - определение семейного рыбака

1 924 550 $ (каждый раз, когда появляется)

$ 2,044,225 (каждый раз, когда появляется)

Раздел 101 (51D) - определение должника малого бизнеса

2,566050 $ (каждый раз, когда он появляется)

$ 2,725,625 (каждый раз, когда появляется)

Раздел 109 (e) - лимиты долга для подачи заявления о банкротстве в соответствии с главой 13

394 725 $ (каждый раз, когда появляется)

$ 1,184,200 (каждый раз, когда он появляется)

419 275 $ (каждый раз, когда он появляется)

$ 1,257,850 2

Раздел 303 (b) - минимальные совокупные требования, необходимые для подачи недобровольной петиции

по главе 7 или 11.

(1) - в части (1)

$ 15,775

$ 16 750

(2) - в части (2)

$ 15,775

$ 16 750

Раздел 507 (а) - приоритетные расходы и претензии

(1) - в части (4)

$ 12 850

$ 13 650

(2) - в пункте (5) (B) (i)

$ 12 850

$ 13 650

(3) - в пункте (6) (B)

$ 6 325

$ 6 725

(4) - в пункте (7)

$ 2 850

3 025 долл. США

Раздел 522 (d) - стоимость имущественных льгот, разрешенных должнику

.

(1) - в части (1)

$ 23 675

25 150 долл. США

(2) - в части (2)

$ 3 775

4 000 долл. США

(3) - в части (3)

600 долларов США

$ 12 625

$ 625

$ 13 400

(4) - в части (4)

1600 долларов США

$ 1,700

(5) - в части (5)

$ 1,250

$ 11 850

$ 1,325

12 575 долларов США

(6) - в пункте (6)

$ 2 375

$ 2,525

(7) - в пункте (8)

$ 12 625

$ 13 400

(8) - в пункте (11) (D)

$ 23 675

25 150 долл. США

Раздел 522 (f) (3) - исключение из расторжения права удержания в соответствии с законами некоторых штатов

$ 6 425

$ 6 825

Раздел 522 (f) (4) - предметы, исключенные из определения предметов домашнего обихода в целях избежания залога

675 $ (каждый раз появляется)

725 $ (каждый раз появляется)

Раздел 522 (n) - максимальная совокупная стоимость активов на индивидуальных пенсионных счетах, освобожденных от налога

$ 1 283 025

$ 1 362 800

Раздел 522 (p) - освобождение от уплаты налога на усадьбу

$ 160 375

$ 170 350

Раздел 522 (q) - освобождение от уплаты налогов штата

$ 160 375

$ 170 350

Раздел 523 (a) (2) (C) - исключения из выписки

(1) - в параграфе (i) (I) - потребительские долги за предметы роскоши или услуги, возникшие менее чем за 90 дней до подачи заявки, причитающиеся одному кредитору в совокупности

$ 675

725 долларов США

(2) - в пункте (i) (II) - авансы наличными, понесенные менее чем за 70 дней до подачи в совокупности

950

1000 долларов США

Раздел 541 (b) - собственность исключений по наследству

(1) - в пункте (5) (C) - средства IRA на образование в совокупности

$ 6 425

$ 6 825

(2) - в пункте (6) (C) - предварительно приобретенные кредиты на обучение в совокупности

$ 6 425

$ 6 825

(3) - в пункте (10) (C) - квалифицированные средства программы ABLE в совокупности

$ 6 425

$ 6 825

Раздел 547 (c) (9) - преференции, доверительный управляющий не может уклоняться от передачи, если в деле, поданном должником, чьи долги не являются в первую очередь потребительскими, совокупная стоимость имущества составляет менее

.

$ 6 425

$ 6 825

Раздел 707 (b) - прекращение дела по главе 7 или преобразование в главу 11 или 13 (проверка нуждаемости)

(1) - в пункте (2) (A) (i) (I)

7 700 долл. США

8 175 долл. США

(2) - в пункте (2) (A) (i) (II)

$ 12 850

$ 13 650

(3) - в пункте (2) (A) (ii) (IV)

1 925 долларов США

$ 2 050

(4) - в пункте (2) (B) (iv) (I)

7 700 долл. США

8 175 долл. США

(5) - в пункте (2) (B) (iv) (II)

$ 12 850

$ 13 650

(6) - в пункте (5) (B)

1300 долларов США

$ 1 375

(7) - в пункте (6) (C)

$ 700

750 долл. США

(8) - в пункте (7) (A) (iii)

$ 700

750 долл. США

Раздел 1322 (d) - содержание плана по главе 13, ежемесячный доход

700 $ (каждый раз появляется)

750 $ (каждый раз появляется)

Раздел 1325 (b) - глава 13 подтверждение плана, располагаемый доход

700 $ (каждый раз появляется)

750 $ (каждый раз появляется)

Раздел 1326 (b) (3) - выплаты бывшему доверенному лицу по главе 7

$ 25

$ 25

Аналогичные уведомления Судебной конференции Соединенных Штатов Америки о корректировке долларовых сумм в положениях, указанных в подст.(а) этого раздела содержались в следующем:

16 февраля 2016 г., 81 F.R. 8748, действует с 1 апреля 2016 г.

12 февраля 2013 г. , 78 F.R. 12089, действует с 1 апреля 2013 г.

19 февраля 2010 г., 75 F.R. 8747, действует с 1 апреля 2010 г.

7 февраля 2007 г., 72 F.R. 7082, действует с 1 апреля 2007 г.

18 февраля 2004 г., 69 F.R. 8482, действует с 1 апреля 2004 г.

13 февраля 2001 г., 66 F.R. 10910, действует с 1 апреля 2001 г.

3 февраля 1998 г., 63 F.R. 7179, действует с апреля.1, 1998.

Влияние стимуляции глубокого мозга субталамического ядра на распознавание эмоций лица при болезни Паркинсона: критический обзор литературы

Глубокая стимуляция мозга (DBS) субталамического ядра (STN) является эффективным средством лечения болезни Паркинсона (PD). Тем не менее, DBS был связан с определенными немоторными нейропсихиатрическими эффектами, такими как ухудшение распознавания эмоций по мимике. Чтобы исследовать распознавание эмоций лица (FER) после STN DBS, мы провели поиск литературы в электронных базах данных MEDLINE и Web of science.В этом обзоре мы анализируем исследования, оценивающие FER после STN DBS у пациентов с БП, и обобщаем текущие знания о влиянии STN DBS на FER. Большинство исследований, имевших клиническую и методологическую неоднородность, показали, что FER ухудшается после STN DBS у пациентов с БП, особенно в отношении отрицательных эмоций (грусть, страх, гнев и склонность к отвращению). Ухудшение FER после STN DBS может быть связано с функциональной ролью STN в лимбических цепях и вмешательством стимуляции STN с нейронными сетями, участвующими в FER, включая связи STN с лимбической частью базальных ганглиев и пре- и лобных нервов. области.Эти результаты улучшают наше понимание роли STN в интеграции моторных, когнитивных и эмоциональных аспектов поведения в растущей области аффективной нейробиологии. Необходимы дальнейшие исследования с использованием стандартизированных нейропсихологических показателей оценки FER и с включением более крупных когорт, чтобы сделать определенные выводы о влиянии STN DBS на эмоциональное распознавание и его влияние на качество жизни пациентов.

1. Введение

Глубокая стимуляция мозга (DBS) превратилась в один из наиболее эффективных методов лечения двигательных расстройств, при этом субталамическое ядро ​​(STN) является основной мишенью для болезни Паркинсона (PD) [1, 2 ].DBS с помощью высокочастотной электростимуляции (> 100 Гц) конкретных мишеней мозга имитирует функциональные эффекты поражения. Высокочастотная стимуляция оказывает тормозящее действие на активность нейронов; предлагаемые механизмы - это маскировка закодированной информации путем наложения высокочастотного паттерна [3], подавление аномальных бета-колебаний [4, 5], стимуляция ингибирующих афферентов гамма-аминомасляной кислоты (ГАМКергической кислоты) к ядру-мишени [6] или другим эфферентные проекции или проходящие волокна [7], и, наконец, ингибирование производства или высвобождения нейротрансмиттеров и гормонов [8].Тем не менее, стало ясно, что механизмы, участвующие в DBS, более сложны, поскольку нейронные элементы могут возбуждаться или подавляться, достигая новых динамических состояний равновесия и развивая различные формы нейрональной пластичности [9].

Базальные ганглии являются частью кортико-подкорковых сетей, участвующих в отборе (облегчении или торможении) не только движений, но также поведения, эмоций и мыслей. STN, расположенный в диэнцефальном-мезэнцефальном соединении, занимает центральное положение в кортикобазальных ганглиях-таламокортикальных цепях, каждый из которых выполняет сенсомоторную, ассоциативную и лимбическую функции [10].STN функционально можно разделить на сенсомоторную (дорсолатеральную), лимбическую (медиальную) и когнитивно-ассоциативную (вентромедиальную) области [11]. STN является не только ретрансляционной станцией, контролирующей таламокортикальную возбудимость (так называемый «непрямой» путь цепи базальных ганглиев) [11, 12], но также важным входным регуляторным ядром базальных ганглиев, принимающим проекции из лобной коры ( так называемый гиперпрямой путь [13, 14]), таламус и ствол мозга. Действительно, вклад STN в немоторные, особенно лимбические, функции привлекает все большее внимание, основываясь на результатах исследований на животных [15–18], а также исследований пациентов с БП, получающих высокочастотную стимуляцию [19–22].

STN DBS доказал благотворное влияние на различные двигательные симптомы заболевания (особенно тремор, ригидность, двигательные колебания и дискинезии, вызванные леводопой) [23, 24], которые, по-видимому, носят длительный характер [25]. Кроме того, он позволяет значительно снизить (от 50 до 60%) дофаминергические препараты в послеоперационном периоде [24, 26]. Есть также доказательства того, что STN DBS снижает тревогу, боль и немоторные колебания [27], улучшает сон и качество жизни пациентов в целом [23, 28].Тем не менее, сообщалось о побочных эффектах на некоторые нейропсихиатрические, когнитивные и поведенческие симптомы после STN DBS, таких как повышенная апатия [27, 29], импульсивность [27], гипомания [30, 31] и даже попытки или завершение суицида [22, 32]. STN DBS может также привести к ухудшению памяти и общего познания [33, 34], скорости обработки данных [33], внимания [33], беглости речи [33–35] и исполнительных функций [33–35]. Эти побочные эффекты возникают, в частности, у пациентов с БП с предшествующими когнитивными [27] или поведенческими симптомами [23, 36, 37], а также у пожилых пациентов (≥70 лет), пациентов с высоким уровнем допаминергической терапии, сниженным ответом на леводопа и осевыми признаками, такими как постуральные нестабильность и замерзание походки или дизартрия [38, 39].

Среди нейропсихиатрических симптомов БП также сообщалось об изменении распознавания эмоций лица (FER) после STN DBS. Тем не менее, результаты исследований по ФЭР после STN DBS противоречивы [40–49]. Способность распознавать эмоции в выражениях лиц других людей является важным компонентом невербального общения и социальных взаимодействий [50]. Фактически, нарушение FER может привести к плохой социальной интеграции и трудностям в межличностных отношениях, таким как чувство разочарования и социальной изоляции [51], что связано с ухудшением психического здоровья и качества жизни [52, 53].Недостаток в интерпретации социальных и эмоциональных сигналов может повлиять на социальное поведение пациентов с БП и иметь последствия для жизни с членами семьи или опекунами [54].

2. Методы

Для дальнейшего изучения вопроса о FER после STN DBS мы провели поиск литературы в электронных базах данных MEDLINE и Web of science в период с 2000 по 2019 год на предмет исследований, опубликованных на английском языке. Ключевые слова поиска были следующими: распознавание эмоций лица, болезнь Паркинсона, субталамическое ядро ​​и глубокая стимуляция мозга.Критериями включения были (1) исследования, оценивающие распознавание эмоций от лицевых стимулов у пациентов с БП, проходящих STN DBS, и (2) исследования, предоставляющие данные в различных условиях (до или после операции, а также при включенной или выключенной стимуляции). Критериями исключения были (1) обзорные статьи и (2) неподходящий дизайн исследования или стимулы, например аффективные картинки, фильмы и голосовые стимулы. Поиск осуществлялся путем ручного поиска ссылок на найденные исследования. В результате поиска было найдено 24 исследования, из которых 10 были исключены, в результате чего в обзор вошли 14 исследований.Блок-схема исследований, оцениваемых для этого обзора, представлена ​​на рисунке 1. Данные, которые были извлечены из включенных исследований, были следующими: имя авторов, год публикации, размер выборки, характеристики пациентов (пол, возраст, продолжительность, и тяжесть заболевания), тест FER (количество стимулов и эмоций и время отображения), эквивалентная доза леводопы до и после STN DBS, условия оценки (включение или выключение стимуляции и включение или выключение лечения), момент времени оценки после STN DBS и результат по производительности FER (точность ответа и время реакции).Оценка качества исследований проводилась с использованием Методологического индекса нерандомизированных исследований (MINORS) [55], который был больше 10 во всех включенных исследованиях, что свидетельствует о хорошем качестве. В этом обзоре мы обсуждаем расхождения между исследованиями и механизмы, посредством которых STN DBS может влиять на FER у пациентов с БП.


3. Результаты
3.1. Исследования, оценивающие распознавание эмоций лица после STN DBS

Несколько исследований оценивали распознавание эмоциональных выражений лица после STN DBS с относительно противоречивыми выводами.Характеристики исследований по оценке FER у пациентов с БП, перенесших STN DBS, суммированы в таблице 1. В недавнем метаанализе Coundouris et al. [56], исследуя социальную функцию восприятия при БП, субанализ, касающийся DBS, показал, что у пациентов с БП наблюдалось значительное нарушение функций восприятия после операции STN DBS от лицевых или голосовых стимулов по сравнению с подобранной здоровой контрольной группой (HC). Большинство исследований включали пациентов с БП, подходящих для DBS в соответствии со стандартными критериями включения и исключения [57], т.е.е., пациенты с идиопатическим БП и тяжелой двигательной инвалидностью, четкая реакция на леводопа, возникновение инвалидизирующих двигательных осложнений, связанных с леводопой, и отсутствие деменции, значительные нейропсихиатрические расстройства и отклонения на МРТ головного мозга. Всем пациентам была выполнена двусторонняя STN DBS. HC, включенный в некоторые исследования, не имел в анамнезе неврологических заболеваний, травм головного мозга или деменции и чаще всего соответствовал возрасту, полу и уровню образования пациентам с PD. В исследованиях использовались различные лицевые стимулы, наиболее распространенные из которых - серия Экмана и Фризена [58], серия Гесса и Блари [59], набор Ним Стим [60] и база данных эмоциональных лиц, направленная Каролинска [61]. ].Более того, большинство исследований включало различные фоновые нейропсихологические тесты с наиболее распространенными глобальными когнитивными критериями (такими как мини-исследование психического состояния и рейтинговая шкала деменции Маттиса), семантические и фонематические задания на беглость речи и тестирование управляющих функций, такое как тест Струпа, тест и тест сортировки карточек в Висконсине, в то время как лишь немногие использовали зрительно-пространственные тесты [40, 46, 62] и тест распознавания лиц Бентона [41, 42, 44, 46, 49, 62, 63].


Исследование Количество участников (m, f) Тестовые стимулы FER (количество стимулов и эмоций, время отображения) Возраст (лет) Длительность заболевания (лет) ) Оценка Хёна и Яра (до DBS) Среднее светодиодное (мг / день) до DBS // после DBS Условия оценки Время оценки (диапазон) Результат

Schroeder et al.2004 [43] 10 PD (6m, 4f) 4 блока, каждый из 60 преобразованных компьютером лицевых стимулов из серии Экмана и Фризена, 6 эмоций, каждый стимул содержит две эмоции разной интенсивности, время отображения нет данных нет данных нет данных // 600 ON STN по сравнению с OFF STN (med off) месяцев (3-24) после DBS Точность распознавания гнева значительно снижена в состоянии ON STN

Dujardin et al.2004 [40] 12 PD (5m, 7f)
12 HC
12 лицевых стимулов из серий Гесса и Блари (мужские и женские), более 3 секунд 4 (3-5) выкл. состояние мед. До и после операции (мед. по сравнению с мед., STN ВКЛ.) До и через 3 месяца после DBS Подпись. снижение общей точности FER, печали и гнева (тенденция к отвращению) независимо от интенсивности выражения

Biseul et al.2005 [44] Различные пациенты с БП до и после DBS (15 (9 месяцев, 6 дней) в каждой группе, сопоставимы по продолжительности заболевания)
15 HC
55 лицевых стимулов из серии Экмана и Фризена, 7 эмоций, 3 с лет (группа после DBS) лет (группа после DBS) н / д н / д До и после DBS
ВКЛ или ВЫКЛ STN
(в мед. во всех условиях)
До и месяцы после DBS (1-48 месяцев) До и после DBS: знак. снижение точности страха (ON или OFF STN) после DBS
ON vs.OFF STN: нет знака. разница для всех эмоций

Geday et al. 2006 [66] 7 PD
22 HC
6 серий по 30 лицевых стимулов из системы изображений эмпатии, 3 эмоции (печаль, нейтральный, счастье), 3 секунды лет н / д н / д a н / д ВКЛ или ВЫКЛ STN DBS (med off) 3-25 месяцев после DBS Лица были оценены как менее приятные при включении DBS по сравнению с выключенным (оценка по шкале от -3 до + 3)

Drapier et al.2008 [63] 17 PD (11 м, 6 е) 55 лицевых стимулов из серии Экмана и Фризена, 7 эмоций, 3 секунды (в среднем) До и после операции (med on vs. med on, STN ON) 3 месяца до и 3 месяца после DBS Sign. снижение точности распознавания страха и печали

Le Jeune et al. 2008 [42] 13 PD (9m, 4f)
30 HC
55 лицевых стимулов от Экмана и Фризена, 7 эмоций, 3 секунды (в мед.) Pre- vs.послеоперационный период (на мед. по сравнению с мед., ON STN) 3 месяца до и 3 месяца после Подпись. снижение общего FER и оценки страха

Peron et al. 2010 [41] 24 PD STN DBS (17 м, 7f), 20 обработанных апоморфином (APO), 30 HC 55 лицевых стимулов от Экмана и Фризена, 7 эмоций, 3 секунды (на med) Pre и post (med on vs med on, STN ON) 3 месяца до и 3 месяца после DBS Sign.снижение общей точности FER, грусть, страх после DBS

Mondillon et al. 2012 [62] 14 PD (9m, 5f)
14 HC
56 лицевых стимулов в каждом блоке из базы данных эмоциональных лиц, направленной по Каролинской, 7 эмоций, 500 мс н / д post-DBS 4 состояния после операции
(med off, STN OFF; med off, STN ON; med on, STN ON; med on, STN OFF)
Не менее 6 месяцев после (год) ON vs.OFF STN DBS (off med): знак. худшая точность распознавания в состоянии ON
ON по сравнению с OFF STN DBS (on med): лучшая точность распознавания FER в состоянии ON
Большее преимущество FER при комбинировании двух терапий (L-Dopa, DBS)

Aiello et al. 2014 [46] 12 PD (8m, 4f)
13 HC
30 лицевых стимулов из набора Nim Stim Set, 6 эмоций, время отображения нет данных нет данных нет данных До приема (приема и прекращения приема лекарств) vs.после DBS (в медицине, OFF STN и в med, ON STN) До и после DBS:
OFF STN: 5 дней после
ON STN: 2-6 месяцев после
Pre- и post-DBS (на med vs. on med, ON STN): нет признаков. Разница в точности FER
Pre- и post-DBS (на med vs. на med, OFF STN): нет признаков. Разница в точности FER
ВКЛ и ВЫКЛ стимуляция (в среднем): нет признаков. Разница в точности FER

Albuquerque et al. 2014 [47] 30 PD (18m, 12f) 16 лицевых стимулов от CATS, 7 эмоций, без ограничений по времени (в мед.) Pre vs.послеоперационный период (по мед. по сравнению с мед., STN ON) До DBS и через 1 год после Нет признаков. разница в точности выполнения заданий FER (ни для положительных, ни для отрицательных эмоций)

Mermillod et al. 2014 [65] 14 PD (9m, 5f)
14 HC
105 лицевых стимулов из серии Экмана и Фризена в широком (BSF), высоком (циклы / изображение) и низком (циклы / изображение) пространственно-частотном разрешении, 7 эмоций, 200 мс н / д post-DBS Post-DBS (4 состояния: med off, STN OFF; med on, STN OFF; med off, STN ON; med on, STN) ВКЛ) Не менее 6 месяцев после DBS (лет) ВКЛ vs.ВЫКЛ: нет знака. эффект стимуляции для забоев BSF и LSF, более низкая общая точность FER для HSF в состоянии ON

McIntosh et al. 2015 [49] Две ранние группы PD: 7 PD (5 месяцев, 2 дня) оптимальная лекарственная терапия, 9 PD (8 месяцев, 1 день) оптимальная лекарственная терапия и STN DBS, 21 подходящий молодой и 23 пожилых HC Лицевые эмоциональные стимулы от ТАСИТ (Часть EET, 28 стимулов) и тест RMET (36 изображений), сложные эмоции, время отображения нет данных (оптимальная лекарственная терапия + группа DBS) нет данных ≤2 (оптимальная лекарственная терапия + DBS группа) ON лекарственная терапия и оптимальная DBS
OFF med (24 часа) и OFF DBS (24 часа)
н / д Нет разницы в точности между группами PD (оптимальная лекарственная терапия или оптимальная лекарственная терапия и DBS) или условия лечения (ВКЛ., ВЫКЛ.)

Enrici et al.2017 [48] 18 PD (9m, 9f) STN DBS
20 PD получение DRT
20 HC
60 изображений теста Экмана, 6 основных эмоций, время отображения нет данных (группа STN-DBS) (Группа STN-DBS) (в med) STN-DBS группа:
DRT-PD группа:
On med (группа DRT-PD) в med, ON STN (группа STN-DBS) 1,72 ( ± 1,18) лет Статистических признаков нет. Различия в точности FER между группами DRT-PD и STN-DBS

Wagenbreth et al.2019 [45] 14 PD (10m, 4f) Неявная и явная задача обработки эмоций, области вокруг глаз из теста Экмана 60 лиц, 112 стимулов (16 лиц, 96 слов),
4 эмоции (счастье, страх , отвращение, нейтральный), без ограничения по времени
нет данных Post-DBS Включено, ВКЛ. -77 месяцев) STN-DBS ON vs. OFF: для задачи явной обработки эмоций в состоянии ON общее снижение точности ответа, знак.снижение точности и увеличение времени реакции на отвращение, повышение точности при страхе

Сокращения: STN: субталамическое ядро; DBS: глубокая стимуляция мозга; FER: распознавание эмоций лица; PD: болезнь Паркинсона; HC: здоровый контроль; sd: стандартное отклонение; н / п: нет в наличии; м: самец; f: самка; 7 эмоций: счастье, грусть, страх, удивление, отвращение, гнев и отсутствие эмоций; мс: миллисекунды; Светодиод: эквивалентная доза леводопы; против.: против; знак .: значительный; med: лекарства; ПО СТН: при стимуляции; OFF STN: отключение стимуляции; DRT: заместительная терапия дофамином; CATS: комплексная система тестирования эмоций; ТАСИТ: Тест на осведомленность о социальном выводе; EET: Emotion Evaluation Test; RMET: задача чтения мыслей в глаза; BSF: широкая пространственная частота; HSF: высокая пространственная частота; LSF: низкая пространственная частота. Рассчитано на основе отчетных данных. Примечание: результат относится к сравнению различных состояний пациентов с БП (не сравнения с ГК).

Что касается методологии исследований, проведенных до сих пор, пациенты были протестированы в чередующихся экспериментальных условиях с включенной или выключенной стимуляцией и включением или выключением лекарств, например, DBS ON / med on, DBS ON / med off, DBS OFF / med on и DBS OFF / med off. В исследованиях сравнивали предоперационное и послеоперационное состояние после STN DBS в одной и той же группе PD [40–42, 63, 64], совпадающих группах PD [44, 48, 49] или пациентах на PD с подобранным HC [46, 48, 62, 65]. В большинстве исследований сообщалось о нарушении FER после STN DBS по сравнению с тем, что было до операции [40–44].Распознавание отрицательных эмоций преимущественно ухудшалось после DBS [40, 43, 44, 63]. Тем не менее, у других не было обнаружено значительного изменения FER после операции [46–49]. В одном исследовании [62] сообщается, что комбинированные эффекты DBS и L-допы были полезны для распознавания эмоциональных выражений лица. Кроме того, в нескольких исследованиях сравнивали состояние послеоперационной стимуляции DBS при включенном и выключенном состоянии у пациентов с БП [43, 45, 46, 62]. Aiello et al. [46] и Mondillon et al. [62] не показали значительной разницы в FER после STN DBS со стимулятором, включенным или выключенным, пока пациенты принимали лекарства.В состоянии отсутствия приема лекарств пациенты с БП проявляли худшее распознавание FER в состоянии стимуляции ON, чем в состоянии OFF [62]. Более того, Geday et al. [66] сообщили, что стимуляция STN влияет на общее восприятие мимики; то есть они были оценены как менее приятные в состоянии ВКЛ, чем в состоянии ВЫКЛ. Наконец, Wagenbreth et al. [45] в недавнем исследовании оценивали послеоперационных пациентов с БП в явной задаче эмоциональной обработки, где пациенты должны были назвать эмоциональный статус, отображаемый в области глаз, и показали общее снижение точности ответа при STN DBS в состоянии ON по сравнению с состояние ВЫКЛ.

Что касается распознавания определенных эмоций (то есть семи основных эмоций: счастья, удивления, страха, гнева, печали, отвращения и нейтральности), несколько исследований показали значительное снижение точности декодирования печали [40, 41, 63] , страх [41, 42, 44, 63], гнев [40] и тенденция к отвращению [40] после DBS по сравнению с предыдущим, хотя не всегда было сравнение с группой HC до операции. Более того, Enrici et al. [48] ​​показали значительное нарушение FER для неожиданности в группе STN-DBS-PD по сравнению с группой HC.Что касается конкретных эмоций в различных условиях стимуляции, Schroeder et al. [43] показали нарушение распознавания гнева у пациентов с БП в состоянии ON STN по сравнению с состоянием OFF, в то время как Mondillon et al. [62] обнаружили значительное снижение распознавания отвращения при стимуляции STN и тенденцию к нарушению распознавания страха при выключенной стимуляции по сравнению с HC (оба без лекарств). Aiello et al. [46] сообщили, что в состоянии ВЫКЛЮЧЕНИЯ вскоре после операции (5 день после операции) у пациентов было нарушено распознавание печали, в то время как через несколько месяцев после (2-6 месяцев) и при включенном стимуляторе у них наблюдалось нарушение распознавания отвращения по сравнению с к HC (что также было очевидно до операции).Кроме того, Wagenbreth et al. [45] показали, что состояние ON STN DBS ухудшает явную обработку материала стимула отвращения (область глаза и слова), но улучшает явную обработку стимулов страха по сравнению с состоянием OFF. Напротив, Biseul et al. [44] показали, что дефицит распознавания страха (по сравнению с дооперационным состоянием и HC) был идентичен у пациентов с БП со стимулятором, включенным или выключенным.

4. Расхождения между исследованиями
4.1. Методологические различия исследований

Большинство исследований, оценивающих FER после STN DBS, имели небольшие размеры выборки (<30), за исключением одного [47].Кроме того, в большинстве исследований результатом была оценка точности выполнения заданий FER без дополнительного измерения времени реакции участников, что в случае продления также указывало бы на нарушение. Причины расхождений между исследованиями могут быть методологическими, касающимися дизайна исследования, то есть задачи FER, условий тестирования или времени оценки. Что касается задач FER, они различались по используемому стимулирующему материалу. В большинстве исследований [41, 42, 44, 63] использовались лицевые стимулы из серии Экмана и Фризена в оригинальной черно-белой версии [58].Тем не менее, в двух исследованиях использовались компьютерно преобразованные стимулы с интенсивностью двух эмоций [43] или промежуточные выражения, различающиеся по эмоциональной интенсивности [40]. В других исследованиях также использовались стимулы, содержащиеся в области вокруг глаз [45, 49]. Реже авторы использовали лицевые стимулы в цвете, такие как база данных эмоциональных лиц, направленная по Каролинской [67] или Nim Stim Set [60]. Также следует иметь в виду методологические недостатки задач FER; в большинстве задач используются статические выражения лица, категоризация и задачи принудительного выбора (наименование эмоциональных лиц), которые менее чувствительны, чем визуальные аналоговые шкалы, в основном из-за предвзятости категоризации [68].Пациенты должны выбрать соответствующий ярлык среди вариантов, которые в большинстве своем являются отрицательными, поэтому вероятность неправильного ответа выше для отрицательных эмоций. Более того, низкоинтенсивные лицевые стимулы связаны с худшими показателями FER [52]. В исследованиях, включенных в наш обзор, не тестировались стимулы различной интенсивности, за исключением одного [40], который показал ухудшение ФЭР после операции независимо от интенсивности стимула. Количество стимулов также варьировалось в разных исследованиях. Другим фактором является время, предоставляемое пациентам для выбора подходящего ответа, которое также варьировалось в разных исследованиях.В случае отсутствия ограничения по времени пациенты могут использовать другие стратегии восприятия [69, 70]. В связи с этим Mondillon et al. [62] использовали дизайн быстрого представления, который может более точно соответствовать микровыражениям, встречающимся в повседневной жизни [71].

Сроки наблюдения после STN DBS также варьировались от дней до 48 месяцев после операции. Фактически, некоторые исследования, тестирующие FER относительно вскоре после операции (3 месяца) [40–42, 63], обнаружили ухудшение FER, тогда как несколько исследований, оценивающих FER позже (через год после операции) [47, 48], этого не сделали.Можно утверждать, что гистологические изменения после операции DBS со временем развиваются по мере развития нейрональной пластичности [9], что затрудняет интерпретацию результатов исследований с разным временем оценки после операции. Более того, различия в характеристиках пациентов могут, по крайней мере, частично объяснять расхождения между исследованиями. Хотя возраст пациентов, продолжительность заболевания и общие когнитивные показатели были сопоставимы между исследованиями, могли присутствовать незначительные когнитивные или аффективные различия.Более того, средний балл Хоэна и Яра был ≤2 в большинстве исследований, посвященных лекарствам [41, 42, 48, 49, 63], тогда как несколько исследований либо не сообщали балл [43–46, 62], либо сообщали о нем без лекарств [ 40]. Несмотря на то, что в большинство исследований включались пациенты в соответствии со стандартными критериями отбора DBS [57], в других были задействованы пациенты с ранней БП [49] или использовались дополнительные критерии, такие как определенный двигательный ответ на DBS или отсутствие дизисполнительного синдрома [62].

4.2. Клинические факторы: влияние расположения электродов, стимуляции и заболевания на изменения распознавания эмоций лица после STN DBS

Большинство исследований FER подтвердили точное размещение электродов DBS с использованием методов визуализации, интраоперационных записей микроэлектродов и стимуляции макроэлектродов, в то время как лишь в нескольких исследованиях сообщалось о дополнительном подтверждении этого. позиционирование электродов с помощью МРТ в послеоперационном периоде [43, 48, 62, 66].Однако в исследованиях не сообщалось об исходах FER в отношении точной локализации электродов DBS и активных контактов, которые могут быть восстановлены с помощью специализированного программного обеспечения на основе послеоперационной визуализации. Таким образом, переменное расположение электродов после STN DBS является фактором, который, возможно, мог объяснить расхождения в наблюдаемых результатах. Другой важный вопрос - как отличить эффекты, вызванные хирургическим вмешательством, от эффектов, вызванных стимуляцией STN. В нескольких исследованиях эта проблема рассматривалась путем сравнения результатов тестов при включенной и выключенной стимуляции [43, 62, 66].Оценка стимуляции OFF выполняется через час после выключения стимулятора; однако даже в этом случае эффекты стимуляции присутствуют, что означает, что это не полное состояние «ВЫКЛЮЧЕНО». Это время соответствует времени до появления большинства моторных симптомов [72], но неясно, что происходит с немоторными эффектами. Более того, то же самое относится и к длительной нервной реорганизации после стимуляции STN [9], которую нельзя устранить простым выключением стимулятора [54].Кроме того, конфигурация контакта (биполярная или монополярная) и параметры стимуляции, включая частоту, ширину импульса и особенно интенсивность стимуляции, варьировались между пациентами в разных исследованиях, что приводило к разному объему стимулируемой ткани ядра и, таким образом, к различным немоторным и эмоциональным эффектам [73, 74] . Действительно, изменение параметров стимуляции часто может уменьшить вызванные стимуляцией поведенческие проблемы [75]. В этом отношении только половина исследований сообщала о параметрах стимуляции пациентов с БП [41–43, 45, 46, 49], которые были выбраны на основе оптимального двигательного эффекта пациентов.

Другая проблема заключается в том, действительно ли пациенты с ПД с нормальным функционированием FER до и с дефицитом после DBS имели тонкий дефицит FER до выявления DBS после операции. Действительно, пациенты с БП демонстрируют значительные социальные дефициты восприятия, включая нарушение ФЭР [56, 76]. Области, вовлеченные в процесс распознавания эмоций на лицах, такие как миндалина, базальные ганглии, островок, орбитофронтальная и передняя поясная кора, поражены патологией, связанной с БП [77]. Не во всех исследованиях изучали наличие дефицита FER до операции по сравнению с HC.Например, пациенты с БП в исследовании Aiello et al. [46] имели нарушение FER (отвращение, прием лекарств) по сравнению с HC даже до DBS, в отличие от других исследований. Что касается того, связано ли ухудшение FER после DBS STN с естественным прогрессированием заболевания [78] или, скорее, с эффектом DBS, исследования показали дефицит FER уже через три месяца после DBS у пациентов с PD, у которых был сохранен FER до операции [40– 42]. Более того, McIntosh et al. [49], которые набирали пациентов с ранним БП, рандомизированных в две группы БП (оптимальная лекарственная терапия или оптимальная медикаментозная терапия и DBS), использовали различные аффективные задачи, включая небольшое количество лицевых эмоциональных стимулов, и обнаружили ухудшение оценки эмоций у пациентов с БП, в отличие от здоровых участников. но никакой разницы независимо от типа лечения или состояния лечения (ВКЛ., ВЫКЛ.).

5. Как STN DBS может повлиять на распознавание эмоций лица в PD
5.1. Лимбическая роль STN

Большое количество структур, включая орбитофронтальную кору, переднюю поясную кору, миндалевидное тело, правую теменную кору и области обработки изображений, такие как затылочно-височная кора, участвуют во многих процессах и в различные моменты времени в распознавании. эмоций в лицах [79, 80]. Более того, нервные субстраты, ответственные за FER, включают лимбическую петлю базальных ганглиев [81].STN можно рассматривать как часть широко распространенной нейронной сети, участвующей в FER, либо посредством обработки лимбической, то есть эмоциональной и ассоциативной информации внутри самого ядра, либо посредством ее воздействия на другие подкорковые и корковые лимбические области. Лимбическая часть STN частично реципрокно связана с лимбическими частями базальных ганглиев [82, 83], такими как вентральное полосатое тело [84, 85] и вентральное паллидум [11], основная область выхода лимбической цепи [81]. . Существуют также эфференты от STN к черной субстанции, в основном к pars reticulata [86], ответственной за регуляцию высвобождения дофамина [11, 87], педункулопонтинному ядру [88] и миндалевидному телу [89, 90].Кроме того, медиальный (лимбический) кончик STN проецируется в вентральную тегментальную область, из которой берет начало мезолимбический дофаминергический путь, участвующий в обеспечении первичного мотивационного поведения [11]. STN также является частью непрямого пути, соединяющего полосатое тело и внутренний бледный шар, который считается «стоп-сигналом» или «запрещающим» путем, снижающим таламическую и корковую активность [91]. Кроме того, STN получает входные данные непосредственно из коры через гиперпрямой путь [14] и, в частности, из лобных и префронтальных областей, таких как передняя поясная кора [13, 92] и орбитофронтальная кора [90, 93], которые участвуют в распознавании. эмоций в лицах [79, 80].

Действительно, различные исследования подтверждают участие STN в лимбических функциях. Vicente et al. [94] сообщили, что стимуляция STN влияет на субъективное восприятие эмоций, а Serranova et al. [95] показали, что аверсивные стимулы оценивались как более неприятные при включенном STN DBS по сравнению с выключенным. Напротив, в исследовании Schneider et al. [96], стимуляция (ON) имела положительный эффект индукции настроения и улучшала эмоциональную память. Нейрофизиологические исследования также подтверждают лимбическую роль STN.Kühn et al. [97] показали модуляцию альфа-активности потенциала местного поля STN через несколько дней после DBS на лекарствах в ответ на эмоционально возбуждающие картинки (независимо от валентности, то есть направления поведенческой активации от неприятных или к приятным стимулам). Напротив, Brücke et al. [98] и Huebl et al. [99] обнаружили значительную модуляцию альфа-активности STN с эмоционально возбуждающими картинками, которые коррелировали с валентностью, но не с возбуждением, то есть с интенсивностью эмоциональной активации [98].В связи с этим Sieger et al. [100] показали, что активность некоторых нейронов STN связана с эмоциональной валентностью, тогда как активность различных нейронов отвечает на возбуждение. Более того, функциональные нейровизуализационные исследования подтверждают участие STN в эмоциональных процессах, например, при просмотре вызывающих эмоции отрывков из короткометражных фильмов (таких как отвращение, веселье и сексуальное возбуждение [101]) или изображений любимых людей (материнская и романтическая любовь [102] ]).

Следовательно, изменения в задачах эмоциональной обработки после STN DBS, такие как ухудшение FER, могут быть отнесены к прямому влиянию DBS на STN или нарушению его связей с другими базальными ганглиями или кортикальными областями, вовлеченными в FER, после операции.Интересно, что STN DBS может модулировать нервные функции по-разному, включая как краткосрочные, так и долгосрочные механизмы нейропластичности [89]. Peron et al. [73] предполагают, что STN DBS может вносить нестабильность в систему базальных ганглиев, которая синхронизирует нервную активность отдельных областей, участвующих в FER, таких как орбитофронтальная кора и миндалевидное тело [42], или распознавание лицевых стимулов, таких как веретенообразная область [66]. ]. Haegelen et al. [103] предполагают, что ингибирование STN с помощью DBS может приводить к неспособности передачи корковой информации в лимбические области, такие как ретикулатная часть черной субстанции и вентральная тегментальная область, на которые дополнительно влияет дофаминергическая потеря при БП.Другая гипотеза, основанная на модели Грейбила [104], заключается в том, что базальные ганглии и, в частности, лимбическая цепь, включая STN, выбирают эмоциональные паттерны без сознательного контроля (точно так же, как они выбирают двигательные паттерны) на основе их связей с корковыми и подкорковыми областями. STN DBS нарушит этот процесс координации и приведет к неправильной интерпретации эмоциональных стимулов. Другой механизм, объясняющий, как STN DBS может приводить к ухудшению FER, - это модуляция осцилляторной активности STN [4, 5, 105, 106].В самом деле, растет роль низкочастотных альфа- и бета-колебаний в STN при БП, которые не являются исключительно моторными [107] и, по-видимому, участвуют в лимбической и эмоциональной обработке информации [108]. Фактически, области STN, участвующие в происхождении бета-активности, проецируются не только на сенсомоторные области, но также и на области, связанные с когнитивными, поведенческими и эмоциональными функциями, такие как префронтальные, лобные, сенсорные и височные области более высокого порядка [107].

5.2. Изменения церебрального метаболизма после STN DBS

Исследования нейровизуализации показали изменения метаболизма глюкозы или регионарного кровотока после STN DBS в областях, связанных с обработкой эмоций лица.Действительно, многие исследования ПЭТ показали снижение метаболизма в состоянии покоя после DBS (в состоянии ON) в прецентральных, лобных областях, таких как передняя поясная извилина [109–111] и височные области [42, 110]. Напротив, в других исследованиях было обнаружено значительное усиление регионального мозгового метаболизма в состоянии покоя после STN DBS в лимбических и ассоциативных проекционных территориях базальных ганглиев, таких как префронтальная [112, 113], лобная и передняя поясная корка [66, 113, 114] а также височная и теменная кора [115].Интересно, что Le Jeune et al. [42] сообщили о положительной корреляции между нарушением распознавания страха и изменениями метаболизма глюкозы в правой орбитофронтальной коре. Следовательно, STN DBS может вызывать модификации в стриато-таламо-кортикальных цепях с участием орбитофронтальной и передней поясной коры или модулировать фронтальную сеть, связанную с лимбической и ассоциативной территориями STN. Кроме того, Le Jeune et al. [42] показали усиление активации правой веретенообразной извилины после STN DBS (в состоянии ON), тогда как Geday et al.[66] обнаружили снижение активации (без лекарств), когда пациенты с PD смотрели эмоциональные лица (в отличие от нейтральных лиц) по сравнению с HC. Основываясь на этих наблюдениях, сложность декодирования эмоций пациентами с БП после STN DBS может быть связана с подавлением активности веретенообразной извилины, которая обычно вызывается эмоциональными визуальными стимулами и, в частности, стимулами лица [116, 117] или сеть, включающая веретеновидную извилину и STN [66]. Другие нейровизуализационные исследования [42, 63] показали, что STN DBS может также изменять активность миндалины, ключевой структуры для FER, которая также связана с орбитофронтальной и передней поясной корой [118].Действительно, STN, особенно его передне-вентральная часть, функционально связана с медиальными височными структурами, включая гиппокамп и миндалевидное тело [89, 90, 107]. Более того, часть вентрального пути миндалины, одного из основных эфферентных путей миндалины, проходит близко к (через и вокруг) STN [89] и может быть затронута хирургическим вмешательством.

5.3. Роль нейротрансмиттеров в распознавании эмоций лица после STN DBS

Другой широко обсуждаемый вопрос - это вклад снижения дофаминергической терапии после DBS в нарушение FER.Грей и Тикл-Дегнен [76] в своем метаанализе сообщили, что нарушение распознавания эмоций у пациентов с БП было больше, хотя и незначительно, в гиподопаминергическом состоянии по сравнению с состоянием приема лекарств, что согласуется с предполагаемой ролью дофамина в регуляции эмоций [119]. ]. Напротив, Coundouris et al. [56] в своем метаанализе показали, что пациенты, принимающие лекарственные препараты, имеют значительно больший социальный дефицит восприятия, чем пациенты, не принимающие лекарства, что может быть связано с передозировкой дофаминергической системы в регионах, участвующих в социальном восприятии, которые относительно не пострадали от дофаминергической денервации [56].Следовательно, дофамин может оказывать благотворное влияние на FER скорее на поздних стадиях, чем на ранних стадиях, на которых мезокортиколимбические пути относительно защищены [52]. Более того, дофаминергическая потеря при БП варьирует и прогрессирует по-разному в пораженных областях, включая лимбические области [120]. Если бы нарушение FER после операции DBS на STN было связано исключительно с уменьшением леводопы, снижение эквивалентной дозы леводопы (LED) должно было быть более выраженным в тех исследованиях, показывающих существенное ухудшение FER после DBS, чего не было (снижение LED в диапазоне от 10 до 10). до 76%) [40–42].И наоборот, исследования, которые не обнаружили существенных различий FER, должны были иметь небольшое уменьшение LED, что опять же не имело места (от 19 до 63%) [63, 64]. Peron et al. [41] показали послеоперационный дефицит ФЭР страха и печали независимо от модификации допаминергических препаратов, а Enrici et al. [48] ​​не обнаружили корреляции между FER и LED в двух группах PD (группа PD при дофаминергической терапии и группа PD при STN DBS и дофаминергической терапии). С другой стороны, Mondillon et al. [62] показали больший выигрыш в эффективности FER при сочетании двух терапий (DBS и L-Dopa).Более того, в другом исследовании [121] было обнаружено, что леводопа сокращает время реакции как на лицевые эмоциональные, так и на контрольные подзадачи Струпа у пациентов с БП в послеоперационном периоде. Другое исследование [122], использующее задачу категоризации, зависящую от эмоциональной валентности, через несколько дней после операции с еще не включенным стимулятором, показало, что дофамин усиливает обработку приятной информации.

В исследованиях, оценивающих состояние стимуляции ВКЛ по сравнению с ВЫКЛ, хотя в некоторых исследованиях [43, 62], в других исследованиях [44, 46], не было значительного ухудшения FER при приеме лекарств. .Тем не менее, даже в исследованиях, в которых тестировались пациенты, принимавшие лекарства [40–42, 44, 46–49, 63], неясно, было ли оно «лучшим» из-за потенциальных дофаминергических колебаний [73]. Более того, пациенты не во всех случаях принимали свои обычные лекарства (например, Mondillon et al. [62] определили как принимающие лекарства ситуацию через 1 час после приема 1,5 обычной утренней дозы L-допы). С другой стороны, отказ от лечения определялся как отказ от лечения в течение 12 [43, 46, 62] или 24 часов [49].Основываясь на этих результатах, можно предположить, что нарушение FER после DBS вряд ли может быть объяснено единственным дефицитом дофамина, но L-допа может незначительно влиять на эффекты DBS и до некоторой степени компенсировать ухудшение FER. В самом деле, контролируемые дозы L-допа могут частично корректировать индуцированную стимуляцией инактивацию орбитофронтальной коры и активировать стриатокортикальный контур [62]. Кроме того, дофамин модулирует активность глутаматергических кортикальных и ГАМКергических паллидальных афферентов к STN [88].Более того, как STN DBS, так и дофаминергическое лечение уменьшают патологическое увеличение бета-колебаний [123–125], вызывают функциональное ингибирование STN и обладают синергическим действием (так называемые гипердофаминергические поведенческие эффекты) [27].

В то время как большое внимание было уделено роли дофамина в эмоциональной обработке при БП, другой вопрос, который необходимо решить, - это роль других нейротрансмиттеров. Имеются доказательства того, что серотонин играет роль в эмоциональной обработке лицевых стимулов [126–128] и может модулировать схему базальных ганглиев [129].Действительно, базальные ганглии, включая STN, получают серотонинергическую иннервацию от ядер шва [130]. Таким образом, поведенческие эффекты DBS могут быть вызваны взаимодействием между STN и серотонинергическими нейронами шва среднего мозга [131]. Действительно, двусторонняя высокочастотная стимуляция STN ингибировала скорость возбуждения серотонинергических нейронов в ядре дорсального шва [132] и высвобождение серотонина в префронтальной коре и гиппокампе на моделях БП на животных [133]. Более того, помимо серотонинергических, норадренергические системы, по-видимому, также играют роль в эффектах STN DBS [134].Возможно, что разные функции внутри STN опосредуются разными системами нейротрансмиссии и что разные, но перекрывающиеся популяции нейронов модулируют выход STN [86]. Высокочастотная стимуляция снижает гиперактивность STN и, помимо восстановления функции дофаминергической системы на двигательных территориях, может нарушить баланс между дофаминергической и другими системами нейротрансмиссии [40, 86].

5.4. Вклад когнитивных и других нейропсихиатрических симптомов в распознавание эмоций лица после STN DBS

Эмоции тесно связаны с когнитивными процессами и часто определяются когнитивной оценкой событий в зависимости от значения этих событий для благополучия и целей человека [73] .Фактически, идентификация эмоций может рассматриваться как сложный когнитивный процесс, основанный на многих когнитивных областях, таких как рабочая память, язык и зрительно-пространственное восприятие [78]. Большинство исследований, оценивающих FER после DBS, также измеряли нейропсихологическую функцию [40–42, 44, 46–48, 63]. Что касается вклада когнитивных изменений в ухудшение FER после DBS, то некоторые исследования, которые показали полное или специфическое ухудшение FER для эмоций после DBS, также показали ухудшение когнитивных показателей, таких как беглость речи [40, 41] или корреляция между двумя функциями [46 ], другие - нет [41, 42, 63].Более того, в большинстве исследований не было обнаружено связи между ухудшением FER после DBS и глобальными когнитивными показателями [40, 42, 44, 63] или управляющими функциями [41, 44, 63], которые остались неизменными после операции. Напротив, исследования, в которых не было обнаружено ухудшения FER после STN DBS, сообщили о значительном улучшении некоторых нейропсихологических показателей, таких как краткое обследование психического состояния и немедленное вспоминание [46, 47]. Также следует отметить, что различные задачи, оценивающие распознавание эмоций, различаются в зависимости от требуемых когнитивных ресурсов [52].Вклад снижения зрительно-пространственного восприятия после операции в ухудшение FER также является спорным вопросом, поскольку в некоторых исследованиях сообщалось об ухудшении зрительно-пространственных способностей после операции [135, 136], тогда как в других [40] было обнаружено нарушение FER без дефицита зрительно-пространственного восприятия. Примечательно, что не во всех исследованиях проводился неэмоциональный тест на распознавание лиц, такой как тест Бентона (хотя такие нарушения не характерны для пациентов с БП), и только в двух исследованиях [43, 62] тестировалась чувствительность к визуальному контрасту.Зрительная и эмоциональная системы действительно тесно связаны: миндалевидное тело связано с верхним бугорком, передней поясной извилиной, орбитофронтальной и корковой височными зонами зрения [137], но маловероятно, что сложный процесс эмоционального распознавания зависит исключительно от способностей зрительного восприятия, которые участвуют в довольно ранних стадиях ТЭР [79].

Обычным нейропсихиатрическим эффектом STN DBS является модуляция тормозящего контроля [138]. STN DBS может изменять импульсный контроль и в некоторых случаях вызывать или усугублять определенное импульсивное поведение у пациентов с БП [139].Торможение как когнитивный процесс имеет важное значение для обработки эмоций [73]. Действительно, тормозящий (запретительный) сигнал от STN, опосредованный связями с лобными областями [138], задерживает автоматические реакции и дает дополнительное время для центральной обработки поведения [140]. С другой стороны, можно предположить, что ухудшение FER после DBS может быть частично связано с нарушением контроля торможения, что приводит к более импульсивным решениям и неточному выбору правильной эмоции. В этом случае время реакции после предъявления лицевых эмоциональных стимулов будет короче в состоянии ВКЛЮЧЕНО, подобно глобальному уменьшению времени реакции в ответ на интенсивные конфликты [140, 141].В большинстве исследований время реакции на задачи FER не оценивалось. Исследование [121] с использованием эмоционального задания Струпа показало, что стимуляция (состояние ON) значительно сокращает время реакции, тогда как другое исследование [45] показало более длительное время реакции, особенно для распознавания отвращения, независимо от состояния стимуляции. Потенциальное участие тревожности, депрессии или апатии в нарушении ФЭР после DBS - еще одна проблема, которая широко не рассматривалась в исследованиях, возможно, потому, что пациенты с серьезными аффективными расстройствами были исключены до операции.Тем не менее, нарушение ФЭР при БП происходит независимо от депрессивного статуса пациента [76]. Интересно, что Dujardin et al. [40], которые обнаружили ухудшение FER, обнаружили снижение тревожности после операции. В исследовании Albuquerque et al. [47], психоневрологические симптомы (апатия и депрессия) нельзя было предсказать с помощью тестов на распознавание эмоций. Более того, Drapier et al. [63] не обнаружили корреляции между послеоперационным ухудшением апатии и распознаванием эмоций и предположили, что каждая из этих функций имеет отдельные функциональные сети, вероятно, проходящие через STN.С другой стороны, Enrici et al. [48] ​​обнаружили значительную отрицательную корреляцию между апатией и показателями FER в обеих группах PD (получающих дофаминергическую терапию или одновременно дофаминергическую терапию и STN DBS).

5.5. Neurosurgical Issues

Нейрохирургической мишенью для DBS при БП является сенсомоторная область STN (дорсолатеральная территория). Однако небольшой размер этой структуры (приблизительно) по сравнению с размером каждого контакта имплантированного электрода () предполагает, что DBS может влиять на другие области STN, кроме моторной, и особенно на ее лимбическую территорию, посредством диффузии тока в зависимости от импульса. ширина и напряжение [40].Более того, кажется, что существует существенное перекрытие между различными областями STN [13], и есть доказательства, что они связаны ГАМКергическими интернейронами [142]. Действительно, Lambert et al. [89] сообщили, что большинство областей коры имеют проекции на все функциональные субтерритории STN и наоборот. Другим фактором является роль хирургической траектории для размещения электродов: электроды вводятся через лобные доли (и, возможно, дорсолатеральную префронтальную кору) и часто вызывают повреждение волокон, соединяющих таламус или головку хвостатого ядра с лобными долями, которые регионы, вовлеченные в высшие когнитивные процессы [36].Действительно, York et al. [143] отметили, что когнитивные и эмоциональные изменения через шесть месяцев после двустороннего STN DBS могут быть связаны с хирургической траекторией и размещением электродов. Имплантация электрода может также повлиять на различные когнитивные функции, такие как внимание и рабочая память [33], а также на выполнение пациентами задач распознавания эмоций за счет повышения импульсивности [138]. Существует также эффект «микроповреждения», который отражает посттравматическую реакцию ткани внутри STN, вызванную имплантацией электродов [144].Этот эффект, хотя обычно кратковременный и с меньшей вероятностью влияет на исход DBS, может вызывать изменения в региональном метаболизме в STN, бледном шаре, вентральном таламусе и сенсомоторной коре головного мозга [145, 146].

5.6. Латерализация

Связи между STN и корой ипсилатеральные [89]. Эмоциональные слуховые стимулы вызвали активность в правом вентральном STN в электрофизиологическом исследовании [147]. Другое исследование [121] пришло к выводу, что STN DBS вызывает гипоактивацию правой веретенообразной извилины.Более того, визуализирующее исследование [66] показало, что подавление активности боковой веретенообразной области лица было результатом стимуляции правой STN. В другом исследовании нейровизуализации [107] была обнаружена асимметрия у пациента с гипоманиакальными эпизодами, вызванными DBS, при этом левый STN показал более низкую связь с префронтальной корой. Кроме того, Lambert et al. [89] сообщили о частично асимметричных проекциях STN, при этом височный полюс в пользу левого, а орбитальная извилина - в пользу правого.Все лимбические связи были более выражены в левом полушарии, за исключением правостороннего преобладания связей со средней лобной извилиной, средней передней поясной извилиной и верхней прецентральной извилиной [89]. Таким образом, может иметь место латерализация в пользу правого STN в соответствии со знанием того, что правое полушарие обычно более активно в эмоциональной обработке [148]. Интересно, что Coundouris et al. [56] в своем метаанализе обнаружили, что пациенты с левосторонним дебютом БП, то есть с патологией, вызванной правым полушарием, обладают более низкой способностью распознавать эмоции.Поскольку в большинстве исследований этот параметр не рассматривался, в будущих исследованиях можно было бы изучить влияние переменной стимуляции правильного STN на социальные способности или даже на инактивацию в конкретных (эмоционально требовательных) социальных ситуациях [66].

5.7. Влияние STN DBS на определенные эмоции

Что касается неправильной атрибуции эмоций, Biseul et al. [44] обнаружили, что наиболее частой ошибочной интерпретацией страха в группе послеоперационной БП было неожиданность, в то время как Peron et al. [41] сообщили, что образец неправильной атрибуции не изменился по сравнению с тем, что было до операции.Неправильная атрибуция отрицательных эмоций может быть вызвана разными причинами. Негативные эмоции, как правило, труднее распознать [149, 150], имея перекрывающиеся черты, в отличие от счастья, которое можно легко распознать по улыбке [151, 152]. С другой стороны, это могло быть связано с общим усилением положительного аффекта, который был связан с STN DBS [96, 153]. Похоже, что некоторые нервные области задействованы в восприятии всех основных эмоций, таких как миндалевидное тело, вентральное полосатое тело, лобная и височная области [154–156], но паттерн активации распознавания отдельных эмоций частично различен [154].Кроме того, одна нейронная структура может выполнять несколько функций в зависимости от функциональной сети и паттерна коактивации в данный момент [155]. Другая причина может заключаться в том, что области, связанные с распознаванием негативных эмоций, могут быть подвержены большей дофаминергической денервации при БП, такие как миндалина, островок, орбитофронтальная и передняя поясная корка [157–159], или что они вовлечены в архаичную систему. эволюционно сохранившийся маршрут, ответственный за распознавание угрожающих стимулов, которые могут быть затронуты при БП [160].Однако неясно, связаны ли STN или его подобласти с обработкой отрицательных эмоций сетью. Le Jeune et al. [42] предположили, что сеть отрицательных эмоций проходит через STN, тогда как Peron et al. [73] предположили, что STN DBS вызывает модификации всех компонентов эмоции независимо от валентности стимула (положительной или отрицательной). Поскольку счастье было единственной положительной эмоцией, протестированной в ходе исследований (удивление можно рассматривать как переходную эмоцию), анатомические основы положительных эмоций гораздо менее изучены (за исключением верхней височной извилины и передней поясной извилины для обработки счастья) [156 , 161]), будущие исследования должны включать больше положительных эмоций (напр.g., благодарность, безмятежность, надежда, гордость, веселье, вдохновение и облегчение), а также более сложные отрицательные эмоции (например, раздражение, тревога, вина, отчаяние и ревность).

5.8. Существуют ли факторы риска для изменения распознавания эмоций лица после STN DBS?

Похоже, что различные факторы риска, такие как уязвимость пациентов перед DBS, дозировка дофамина или стимуляция [37], могут влиять на нейропсихиатрический исход STN DBS. Действительно, пациенты с пограничным когнитивным или поведенческим функционированием, такие как пожилые пациенты, подвержены риску развития послеоперационной поведенческой декомпенсации [162].Другими факторами, которые могут объяснить, почему такие поведенческие симптомы различаются между пациентами после операции, могут быть личностные черты, социальная среда, культурные различия и усвоенное поведение [36]. Также следует принимать во внимание анатомическую изменчивость между субъектами [107] и изменчивость с точки зрения когнитивных способностей (например, легкие когнитивные нарушения). Другой аспект, который может быть изучен в будущих исследованиях, заключается в том, происходит ли ухудшение FER после DBS в подгруппе пациентов с отчетливыми немоторными характеристиками, т.е.д., преобладающий немоторный подтип, например, подгруппа с преобладанием неремора, которая больше связана с когнитивными и аффективными симптомами [120], или диффузный фенотип, который, вероятно, будет иметь легкие когнитивные нарушения, ортостатическую гипотензию и расстройство поведения во сне в фазе быстрого сна на исходном уровне и в более быстрое прогрессирование немоторных симптомов [163]. Argaud et al. [52] предположили, что гипомимия может играть роль в трудностях эмоциональной обработки при БП. Таким образом, предметом будущих исследований может быть также изучение гипомимии после STN DBS в связи с изменением FER.Таким образом, существует сложная взаимосвязь между предрасположенностью, хирургическими и послеоперационными проблемами.

6. Заключение

Таким образом, большинство опубликованных к настоящему времени исследований показали, что распознавание лицевых эмоций у пациентов с БП после операции DBS на STN ухудшается по сравнению с состоянием до операции [40–42, 63], в то время как несколько исследований не показали. значительное нарушение FER после STN DBS [46, 64]. Кроме того, исследования показали худшую FER в состоянии ON STN по сравнению с OFF без дофаминергических препаратов [43, 62], в то время как при приеме лекарств не сообщалось о значительной разнице [46, 62].Основные выводы и соображения, касающиеся влияния STN DBS на FER, суммированы в таблице 2. Следует признать ограничения текущего обзора, такие как небольшие размеры выборки исследований, различные периоды наблюдения после операции и, возможно, различная чувствительность Среди исследований использовалось тестирование FER, а также тот факт, что исследования были в основном наблюдательными, а не рандомизированными контрольными исследованиями. Более того, нельзя исключить, что исследования с положительными результатами были опубликованы с большей вероятностью по сравнению с исследованиями, не показавшими никаких различий после DBS.Кроме того, исследования проводились на пациентах с БП, у которых вовлечение СТЯ могло отражать компенсаторную реакцию. Тем не менее, данные указывают на функциональную роль STN в лимбических цепях. Действительно, существуют различные факторы, которые необходимо выяснить в будущих исследованиях, такие как методологические расхождения в исследованиях, нейрохирургические проблемы, роль самого заболевания и роль дофаминергических препаратов. В настоящее время также неясно, являются ли послеоперационные изменения ФЭР преходящими или стойкими.Следовательно, необходимы долгосрочные последующие исследования с тестированием в различные моменты времени после операции. Более того, в будущих исследованиях следует тестировать более крупные когорты пациентов с использованием стандартизированных подтвержденных нейропсихологических показателей FER, которые будут включать все основные эмоции и измерять как точность ответа FER, так и время реакции в качестве результата. Кроме того, в будущих исследованиях было бы интересно посмотреть на корреляцию результатов FER с положением электрода по отношению к STN и объему ткани, активированной DBS.


(i) Большинство исследований, имевших клиническую и методологическую неоднородность, показали, что FER у пациентов с БП ухудшается после STN DBS по сравнению с дооперационным, особенно из-за отрицательных эмоций (грусть, страх , гнев и склонность к отвращению).
(ii) Большинство исследований показали худшую FER в состоянии ON STN по сравнению с OFF без дофаминергических препаратов, в то время как при приеме лекарств существенной разницы не было.
(iii) Нейрофизиологические исследования показали модуляцию альфа-активности STN после DBS в ответ на эмоционально возбуждающие картинки.
(iv) Исследования нейровизуализации показали изменения в метаболизме глюкозы или региональном кровотоке после STN DBS в областях, связанных с FER, таких как орбитофронтальная кора, передняя поясная кора, веретенообразная извилина или миндалевидное тело.
(v) Нарушение FER после STN DBS вряд ли можно объяснить единственным дефицитом дофамина, возникающим в результате снижения дозы в послеоперационном периоде, но L-допа может незначительно влиять на эффекты DBS и до некоторой степени компенсировать ухудшение FER.
(vi) Связь между ухудшением FER после DBS и глобальными когнитивными показателями не могла быть показана в большинстве исследований, в то время как вклад зрительно-пространственных способностей после операции является спорным вопросом.
(vii) Ухудшение FER может быть связано с нарушением контроля торможения после STN DBS, в то время как потенциальное вовлечение беспокойства, депрессии или апатии в настоящее время неясно.
(viii) Хирургическая траектория, расположение электродов, стимуляция и распространение тока на близлежащую лимбическую территорию STN могут способствовать влиянию DBS на FER.
(ix) Ухудшение FER после STN DBS может быть связано с функциональной ролью STN в лимбических цепях и вмешательством стимуляции STN в нейронные сети, участвующие в FER, такие как связи STN с лимбической частью базальные ганглии и пре- и лобные области.

Изменения FER после STN DBS можно отнести к функциональной роли STN в когнитивных и лимбических цепях [103, 164, 165] или к вмешательству стимуляции STN с интеграцией нейронные сети, участвующие в FER [42, 66].Важно отметить, что сети не статичны, а динамичны [166], адаптируясь к текущим сложным задачам или ситуациям. Таким образом, FER может изменяться с течением времени после DBS. Таким образом, роль STN расширяется: STN представляет собой центральную позицию для многоуровневой интеграции моторной, когнитивной и аффективной информации [107]. DBS препятствует информационному взаимодействию в STN, исходящему из таких структур, как префронтальная кора, передняя поясная извилина и миндалевидное тело. Стимуляция STN способствует задействованию связанных с движением префронтальных областей, что сопровождается улучшением моторики [167, 168]; однако он может оказывать противоположный эффект на ассоциативные и лимбические проекционные области базальных ганглиев и приводить к негибкости психических реакций [169].Следовательно, высокочастотная стимуляция STN способна восстановить моторную цепь, но может вызвать функциональный дисбаланс в немоторной (лимбической) цепи, что может объяснить, почему в большинстве исследований сообщалось об ухудшении FER после DBS.

Выражение лица - это сильное невербальное проявление эмоций, которое передает информацию о валентности другим и является важным элементом коммуникации в социальных взаимодействиях. В будущих исследованиях следует оценить, влияют ли трудности в распознавании и обработке эмоций на качество жизни пациентов и лиц, осуществляющих уход.Действительно, пациенты после операции DBS часто испытывают трудности в отношениях с близкими членами семьи и социально-профессиональным окружением [170]. Нарушение FER может способствовать возникновению этих трудностей в интерпретации социальных сигналов. Другой вопрос заключается в том, можно ли улучшить психоневрологические расстройства после DBS с помощью интервенционных стратегий или даже предотвратить. Это подчеркивает важность нейропсихологического подхода к пациентам с БП после STN DBS, что выгодно в контексте мультидисциплинарной команды, для оптимизации моторных и немоторных исходов DBS.

DBS - это эффективный метод лечения болезни Паркинсона. Существует множество доказательств того, что это более эффективно, чем оптимальная медикаментозная терапия [24]. Тщательно отобранные пациенты, помимо значительного улучшения моторики, испытывают существенное улучшение качества жизни [23], которое преодолевает побочные эффекты. DBS является важным терапевтическим вмешательством для пациентов с трудноизлечимыми двигательными симптомами, у которых немоторные симптомы не являются преобладающими [1, 24], что подчеркивает важность индивидуализации лечения БП в зависимости от симптомов пациента.Аспекты, обсуждаемые в данной статье, улучшают наше понимание роли STN в эмоциональном контроле в растущей области аффективной нейробиологии. Однако влияние STN DBS на способности социального восприятия требует дальнейших исследований. Тщательно разработанные исследования у пациентов с БП до и после STN DBS могут расширить наши знания о роли STN в социальном взаимодействии и лучше информировать индивидуализированные клинические решения о лечении DBS при БП.

Раскрытие информации

Не было написания или редактирования рукописи какой-либо другой стороной, не указанной в списке авторов.Решение о подаче рукописи в публикацию было принято исключительно авторами рукописи.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.

Благодарности

Публикация статьи финансировалась за счет непроектных средств авторов.

Достижения в области многоугольного спутникового дистанционного зондирования отдельных взвешенных в воздухе твердых частиц и их связи с неблагоприятными последствиями для здоровья: от MISR до MAIA

1.

Введение

Многочисленные эпидемиологические исследования предоставили убедительные доказательства того, что вдыхание взвешенных в воздухе твердых частиц (ТЧ) сокращает продолжительность жизни и способствует множеству других проблем со здоровьем, включая болезни сердца, инсульт, нарушение дыхания, рак легких, диабет, снижение когнитивных функций и неблагоприятные исходы родов. 1 - 5 Исследование глобального бремени болезней (ГББ) 6 - 8 ранжирует PM2 в окружающей среде.5 (частицы с аэродинамическим диаметром <2,5 мкм) в качестве основного фактора риска для окружающей среды во всем мире, вызвав около 4,1 миллиона преждевременных смертей в 2016 году. Хотя исследования ГББ и многие другие исследования сосредоточены на воздействии на человека общей массы PM2,5, относительная токсичность конкретных типов ТЧ - смесей частиц с различным распределением по размерам и химическим составом - остается менее изученным. 9 , 10 Поскольку эти типы часто имеют разные источники, это является серьезным препятствием для целенаправленных мероприятий, которые улучшили бы общественное здоровье.

ТЧ в воздухе представляет собой сложную смесь частиц разного размера, формы и химического состава, происходящих из нескольких источников и подверженных динамическим атмосферным преобразованиям. Проблемы, связанные с изучением воздействия на здоровье различных типов ТЧ, отчасти связаны с неоднородностью свойств частиц и их изменчивостью в пространстве и времени. Хотя наземные мониторы предоставляют наиболее точные доступные средства для измерения массовой концентрации ТЧ и химического состава в фиксированных точках, они недоступны во многих частях развивающегося мира.Мониторы, способные измерять состав ТЧ, особенно редки, и даже если они доступны, им не хватает пространственной плотности, необходимой для оценки мелкомасштабных градиентов воздействия. Как отмечает Всемирный банк, 11 «Нехватка государственных ресурсов ограничивает мониторинг атмосферных концентраций ТЧ в развивающихся странах, несмотря на их большое потенциальное воздействие на здоровье. В результате, политики ... остаются неуверенными в отношении подверженности своих жителей загрязнению воздуха ТЧ ».

Национальная академия наук США уделяет приоритетное внимание улучшению нашего понимания относительной токсичности различных типов ТЧ. 12 Одних только наземных мониторов, особенно тех, которые способны измерять заданные ТЧ, недостаточно для достижения этой цели, поскольку они слишком редки и дороги в установке и обслуживании. Неточные оценки воздействия могут возникать, когда концентрации ТЧ меняются в пространственных масштабах, меньших, чем расстояния между мониторами. 13 Хотя воздействие ТЧ в масштабе нескольких сотен метров может быть важным для людей, живущих вблизи источников загрязнения (таких как основные дороги) или лиц с ограниченной подвижностью (например,g., жители домов престарелых), недавние геостатистические исследования показывают, что большая часть пространственной изменчивости ТЧ адекватно отбирается в масштабах от 1 до 4 км. 14 , 15 Агентство по охране окружающей среды США (EPA) отмечает, что «использование центральных стационарных мониторов для отображения воздействия на население» является ключевым фактором, ограничивающим наши знания о том, какие типы PM представляют наибольшую опасность для здоровья. , 10 и рекомендует проводить мониторинг городских PM в масштабе квартала (0.От 5 до 4,0 км), поскольку он представляет собой условия, в которых люди обычно живут и работают. 16

Спутниковое дистанционное зондирование - в сочетании с измерениями наземного монитора и результатами моделирования химического переноса (CTM) - в настоящее время предлагает практический подход к частому картированию массовых концентраций PM2,5 в масштабе района по всему миру. Агентство по охране окружающей среды США и Национальный институт наук об окружающей среде подчеркивают ценность дистанционного зондирования для «улучшения наземного отбора проб воздуха и помощи в заполнении широко распространенных пробелов в данных, которые препятствуют усилиям по изучению загрязнения воздуха и защите здоровья населения».” 17 Оценки массы PM2,5, полученные на основе спутниковых наблюдений, оказались полезными в эпидемиологических исследованиях. 18 , 19 Поскольку мониторы видообразования ТЧ даже менее распространены (и более дороги), чем те, которые измеряют общие массовые концентрации, будущий прогресс в спутниковых возможностях определения типа частиц и расширение существующих методологий для обработки видообразования будет иметь важное значение. потенциал для улучшения нашего понимания того, какие смеси и источники ТЧ являются наиболее вредными.Эта информация может помочь определить приоритетность рекомендаций по качеству воздуха, облегчить экономически эффективные стратегии мониторинга и смягчения последствий, а также помочь исследованию биологических механизмов документированного воздействия ТЧ на здоровье человека. 12

Панель «Погода и качество воздуха» Десятилетнего обзора наук о Земле и прикладных космических исследований за 2017 год 20 включает в числе своих наивысших приоритетных целей улучшение способности оценивать глобальное воздействие загрязнения воздуха на здоровье человека, а также и поддержание надежной комплексной стратегии наблюдений за пространственным распределением ТЧ (включая видообразование).«Учитывая, что частицы, ответственные за риски для здоровья человека, расположены вблизи уровня земли, Decadal Survey признает необходимость в интегрированной стратегии, сочетающей космические, авиационные и наземные наблюдения, дополненные данными CTM.

За последние два десятилетия мы стали свидетелями значительного прогресса в нашей способности составлять карты содержания аэрозолей и свойств частиц из космоса. Получение аэрозолей над сушей с помощью таких инструментов, как многоугольный спектрорадиометр (MISR), 21 , визуализирующий спектрорадиометр среднего разрешения (MODIS), 22 и датчик с широким полем обзора для наблюдения за морем (SeaWiFS) 23 успешно использовались для создания глобальных карт приповерхностных концентраций мелких твердых частиц и отслеживания многолетних тенденций. 24 , 25 Эти спутниковые карты мелких твердых частиц использовались в ГББ и многих других исследованиях воздействия на здоровье, в том числе нескольких, которые изучали воздействие PM2,5 и функцию легких, заболевание почек, рак легких, рак груди. , сердечные приступы и исходы родов. 7 , 8 , 26 - 32 Эти усилия стали возможными благодаря достижениям в области бортовой аппаратуры и связанных с ней алгоритмов обработки данных.

Текущие усилия в области дистанционного зондирования аэрозолей направлены на улучшение нашей способности определять тип частиц. Было показано, что многоугольные наблюдения, реализованные в спутниковых инструментах, таких как MISR 33 и поляризация и направленность отражений Земли (POLDER), 34 , обеспечивают эффективный способ достижения этой цели. 21 , 35 , 36 Инструмент MISR, созданный Лабораторией реактивного движения (JPL) для полета на космическом корабле НАСА Terra, собирает данные науки о Земле с февраля 2000 года.В этой статье мы кратко рассмотрим применение MISR к дистанционному зондированию аэрозолей и ТЧ. Это обсуждение служит прелюдией к описанию многоугольного тепловизора для аэрозолей (MAIA), 37 , который основан на наследии MISR и в настоящее время находится в разработке в JPL. Ключевые элементы исследования MAIA включают (1) спутниковый инструмент, который включает в себя ряд достижений в измерениях относительно MISR, таких как расширенный спектральный диапазон и поляриметрические изображения, (2) интеграция космических и наземных измерений и выходных данных CTM для создание карт с высоким разрешением на 1-километровой пространственной сетке определенных ТЧ в выбранном наборе глобально распределенных целевых районов и (3) привязка полученных данных о воздействии ТЧ с записями о здоровье человека для оценки воздействия на болезнь.Этот документ предназначен для ознакомления научных кругов, специалистов в области общественного здравоохранения и потенциальных пользователей данных с основными элементами и стратегиями, которые будут использоваться в расследовании MAIA, а также для предоставления обзора текущего статуса разработки проекта.

2.

Многоугольный спектрорадиометр

2.1.

Общие сведения

Прибор MISR 33 был запущен на полярную солнечно-синхронную орбиту на борту космического корабля НАСА Terra 18 декабря 1999 года.Обычные наблюдения Земли начались 24 февраля 2000 г. MISR использует девять отдельных камер для изображения Земли под девятью дискретными углами обзора: 0 ° (надир) и 26,1 °, 45,6 °, 60,0 ° и 70,5 ° вперед и назад от надира. Изображения с пространственным разрешением от 275 м до 1,1 км в полосе обзора шириной 400 км получают в четырех спектральных диапазонах видимого / ближнего инфракрасного (VNIR) (446, 558, 672 и 866 нм) в каждой камере с использованием систем обнаружения движения космических аппаратов и линейных детекторов. MISR был разработан, чтобы улучшить наше понимание климата, экологии и окружающей среды Земли.Набор продуктов 38 подтвержденных геофизических данных создан и заархивирован для публичного распространения в Центре данных по атмосферным наукам в Лэнгли НАСА (ASDC). Обширная библиография рецензируемых публикаций, описывающих, применяющих и подтверждающих данные MISR для исследований аэрозольного климата, качества воздуха и воздействия на здоровье, радиации и взаимодействия облаков с климатом, ветров, отслеживаемых облаками, и науки о биосфере и криосфере на поверхности, доступна на веб-сайт MISR. 39

2.2.

Аэрозольные данные Создание продукта

Одной из целей исследования MISR является глобальное картирование аэрозолей. Прямые радиационные эффекты аэрозолей, как по величине, так и по знаку, зависят главным образом от оптической толщины аэрозоля (AOD), альбедо однократного рассеяния, фазовой функции рассеяния и альбедо подстилающей поверхности. Аэрозоли также оказывают косвенное воздействие на климат и гидрологию, воздействуя на альбедо, продолжительность жизни и микрофизические свойства облаков, и играют важную роль в здоровье человека и окружающей среды.

Наблюдения за яркостью в нескольких углах важны для усиления сигнала аэрозоля относительно отражения от поверхности и обеспечения чувствительности к фазовым функциям рассеяния аэрозоля, которые определяются размером, формой и составом частиц. 40 - 42 Алгоритмы на основе переноса излучения применяются к радиометрически откалиброванным, георективируемым и экранированным облаками многоугольным мультиспектральным изображениям MISR для создания аэрозольного продукта. На суше работают вместе два основных алгоритма.Первый, известный как неоднородная земля, использует пространственные контрасты для получения эмпирической ортогональной функции, представляющей вклад поверхности в измеренное многоугловое сияние. 43 Второй, известный как однородная земля, использует сходство угловой формы поверхностных двунаправленных коэффициентов отражения (BRF) среди четырех спектральных диапазонов в качестве ограничения на извлечение аэрозоля. 44 Оба алгоритма используют многоугольную природу наблюдений MISR.Используя справочную таблицу, состоящую из 74 смесей аэрозольных частиц, имеющих заданные микрофизические и оптические свойства, и используя несколько показателей согласия для сравнения смоделированной яркости в верхней части атмосферы с наблюдениями MISR, алгоритм поиска обеспечивает чувствительность как к AOD, так и виды аэрозолей. 35

2.3.

Приложение к качеству воздуха и здоровью человека

Сравнение AOD MISR с независимыми AOD наземного солнечного фотометра из сети Aerosol Robotic Network (AERONET) 45 показывает высокую положительную корреляцию, 46 , 47 , включая более засушливые земли и городские районы. 48 - 50 В результате MISR является одним из нескольких спутниковых инструментов, вносящих вклад в широко используемые глобальные карты PM2,5. 24 , 25 , 51 Чувствительность MISR к типу частиц позволяет отделить антропогенные аэрозоли от пыли, что привело к улучшенным оценкам приземных концентраций PM2,5 в засушливых западных районах США по сравнению с одноугловые подходы. 52 , 53 Эти многомерные регрессионные модели были первоначально разработаны для изучения способности MISR количественно характеризовать приземные концентрации PM2.5 компонентов, таких как сульфат, нитрат, органический углерод (OC) и элементарный углерод (EC). Позже более гибкая обобщенная аддитивная модель (GAM) с использованием фракционного AOD MISR (разделенного по свойствам частиц), масштабированного по вертикальным профилям аэрозольной нагрузки из транспортной модели GEOS-Chem, смогла объяснить 70% изменчивости концентраций сульфатов, измеренных с поверхности мониторы. 54 Информация о размере и форме частиц, полученная в результате поиска MISR, использовалась для того, чтобы связать антропогенное загрязнение со значительным десятилетним повышением АОТ и приземных PM2.5 над городскими центрами и густонаселенными сельскими районами Индии. 55 , 56

Валидация результатов извлечения аэрозолей MISR с использованием рабочего продукта с разрешением 17,6 км продемонстрировала высокую точность над сушей для AOD <0,5 и систематическое занижение (хотя и высокую корреляцию) при высокой аэрозольной нагрузке. 46 - 50 Иерархическое байесовское моделирование и статистический анализ этого продукта позволили предположить потенциальные преимущества перехода к более высокому пространственному разрешению. 57 , 58 Учитывая ценность более мелких пространственных деталей для исследований качества городского воздуха, алгоритм поиска MISR был недавно адаптирован для работы на пространственной сетке 4,4 км, и прототипирование обновленного кода продемонстрировало значительные улучшения в с точки зрения точности, охвата и отображения пространственных градиентов. 59 Следовательно, рабочий аэрозольный продукт был повышен с пространственного разрешения 17,6 км (версия 22) до 4,4 км (версия 23), а продукт V23 стал общедоступным в конце 2017 года.Пример улучшения пространственного разрешения и покрытия показан на рис. 1. Эти данные получены с эстакады Терра в юго-восточном Техасе и западной Луизиане 14 февраля 2013 г. Продукт с разрешением 4,4 км отлично справляется с обнаружением повышенных AOD. над Хьюстоном и долиной Красной реки.

Рис. 1

Пример сравнения поиска MISR AOD на 17,6 км (V22) и 4,4 км (V23).

Прототипы аэрозольного продукта MISR длиной 4,4 км использовались в некоторых частях южной и центральной Калифорнии для оценки среднесуточных значений PM2.5, PM10 и определенные концентрации PM2,5. Посредством одноразовой перекрестной проверки на соответствие измерениям федерального эталонного метода EPA было показано, что продукт улавливает пространственную изменчивость PM2,5 в масштабе сетки и разделяет режимы размера PM2,5 и PM10 в большом районе Лос-Анджелеса. 60 В другом недавнем исследовании GAM применялись к 15-летнему опыту прототипа 4,4-километрового изделия, и было показано, что GAM способны объяснить 66%, 62%, 55% и 58% изменчивости среднесуточных PM2,5. концентрации сульфата, нитрата, ОС и ЕС. 61

3.

Многоугольный тепловизор для аэрозолей

3.1.

Общие сведения

НАСА выбрало исследование MAIA в 2016 году как часть своей программы Earth Venture Instrument. Инструмент MAIA основан на наследии MISR и добавляет новые возможности измерения для определения общих концентраций мелких (PM2,5) и крупных (PM10-PM2,5) частиц, а также количеств гидратированных неорганических веществ, OC, черного углерода (BC) или ЕС и минеральная пыль в смесях мелких частиц.Интегрированные спутниковые / приземные данные и стратегия моделирования 62 используются для получения среднесуточных значений ТЧ на сетке 1 км. Этот подход позволяет дополнительно разделить неорганические соединения на сульфаты и нитраты. Основные задачи, которые стремится решить MAIA, заключаются в том, чтобы продемонстрировать, что текущие спутниковые стратегии для картирования общей массы PM2,5 могут быть расширены за счет включения видообразования и что этот подход может быть реализован на оперативной основе.

Основная цель MAIA - оценить влияние различных типов переносимых по воздуху ТЧ на здоровье человека.Запланированное расследование состоит из нескольких элементов: (1) спутниковый инструмент MAIA, (2) алгоритмы и программное обеспечение для создания карт PM с использованием данных инструмента MAIA, наземных мониторов и CTM, и (3) эпидемиологические исследования с использованием карт MAIA PM. и геокодированные данные о состоянии здоровья, чтобы связать различные типы PM с неблагоприятными последствиями для здоровья. Увеличивая плотность пространственной выборки и охват PM в целевых регионах, MAIA преодолевает серьезное препятствие, с которым столкнулись предыдущие исследования, изучающие воздействие на здоровье конкретных типов PM, 63 - 67 , а именно их ограниченную способность для точной оценки воздействия из-за небольшого количества наземных мониторов ТЧ.Для поддержки других исследований в области атмосферных наук MAIA планирует собирать измерения в областях, представляющих ценность для изучения воздействия аэрозолей и облаков на климат Земли, а также в отношении экстремальных явлений, таких как лесные пожары, пыльные бури и извержения вулканов. Демонстрация на околоземной орбите новых технологий получения изображений, используемых в приборе MAIA, также будет способствовать планированию НАСА будущих миссий.

3.2.

Конструкция прибора

Прибор MAIA предназначен для объединения мультиспектральных, поляриметрических и многоугольных возможностей в единую интегрированную систему построения изображений, способную отображать общие и расчетные ТЧ в масштабе окрестности.В основе прибора - камера с подвижной щеткой, установленная на двухосном подвесе.

3.2.1.

Спектральный охват

Камера MAIA включает спектральные диапазоны в ультрафиолетовом (УФ), VNIR и коротковолновом инфракрасном (SWIR) диапазонах, что улучшает чувствительность к свойствам аэрозольных частиц по сравнению с диапазонами MISR, предназначенными только для VNIR. Длины волн УФ-излучения используются для обнаружения поглощения гематитом и оксидом алюминия частицами пыли, нитрованными ароматическими и полициклическими ароматическими углеводородами в органических аэрозолях (например,g., коричневый углерод) и BC или EC (сажа). 68 , 69 Использование полос VNIR для тонкодисперсных аэрозолей основано на традициях MISR, MODIS и POLDER. SWIR чувствителен к крупным аэрозолям, 70 , а полоса, расположенная в зоне сильного поглощения водяного пара, обеспечивает улучшенное экранирование перистых облаков. 71 Каналы в пределах и около диапазона A O2 включены для изучения чувствительности к высоте слоя аэрозоля (и облаков). 72 , 73 Таблица 1 суммирует набор спектральных диапазонов MAIA.

Таблица 1

Спектральные полосы MAIA.

Центр полосы (нм) Ширина полосы (нм) Поляриметрический Назначение Условные обозначения для целей спектральной полосы
365 37 1 Аэрозольное и высота
391 39 1 2. Распределение мелких частиц по размерам
415 39 1 3.Показатель преломления аэрозоля
444 53 x 1, 2, 3, 8 4. Поглощение водяного пара
550 43 2, 8, 9 5. Полосы поглощения скобок
646 72 x 1, 2, 3, 8 6. Высота аэрозоля и облаков с использованием диапазона A O2
750 18 2, 5 7.Грубое распределение размеров аэрозолей
763 6 6 8. Отсев и определение облачности
866 52 2, 5, 8, 9 9. Характеристики BRF поверхности
943 46 4
1044 97 x 1, 3, 5, 7, 8
1610 73 7,
1886 83 4, 8
2126 114 7, 8, 9

3.2.2.

Поляриметрия

Как показано в Таблице 1, три полосы MAIA являются поляриметрическими, что обеспечивает дополнительную чувствительность к размеру частиц и их составным параметрам, таким как показатель преломления. 74 - 76 Ограничивая эти свойства частиц, поляризация также работает вместе с излучением, чтобы ограничить поглощение аэрозоля. 77 Чтобы воспользоваться преимуществами поляриметрии в будущих приборах, специалисты по аэрозолям установили требование неопределенности ± 0.005 по степени линейной поляризации, 78 , что более чем в три раза строже, чем у POLDER. Камера MAIA достигает такого уровня точности при пространственном разрешении 1 км (по сравнению с 6 км с POLDER) за счет использования метода модуляции поляризации, обеспечиваемого парой фотоупругих модуляторов и парой ахроматических четвертьволновых пластин. 79 , 80 Это приводит к изменяющимся во времени колебаниям в плоскости линейной поляризации с частотой около 27.5 Гц. Интегральная схема считывания обеспечивает быструю выборку модулированных сигналов во время каждого кадра изображения с кнопками. Кремниевые детекторы используются в УФ / ВНИК и ртутно-кадмиево-теллуридных детекторах в SWIR. Над детекторной решеткой находится набор спектральных фильтров и проводных анализаторов поляризации. Похожая система, работающая в УФ / ВНИР, была реализована в бортовом многоугольном спектрополяриметрическом формирователе изображений JPL (AirMSPI). 81 AirMSPI-2 второго поколения расширяет спектральный диапазон до SWIR. 82 MAIA использует наследие обоих бортовых приборов.

3.2.3.

Многоугольная визуализация, охват площади и пространственное разрешение

Камера MAIA представляет собой четырехзеркальную оптическую систему f / 5,6 с поперечным и продольным фокусными расстояниями в центре оптического поля зрения 57 и 61 мм. , соответственно. Поскольку орбита MAIA еще не известна, эта конструкция рассчитана на любую высоту орбиты от 600 до 850 км. В отличие от MISR, который содержит несколько камер, нацеленных на дискретные углы обзора вдоль пути, одиночная камера MAIA установлена ​​на сборке двухосного карданного подвеса, который может направлять поле обзора камеры на любое положение вдоль пути и поперек пути в двунаправленном поле обзора. .Миниатюрный привод с двойным приводом (MDDA) приводит в движение каждую ось кардана. MDDA использовался в MISR и других спутниковых инструментах и ​​обеспечивает 100% резервирование каждой оси карданного подвеса и устойчивость к механическим или электрическим неисправностям в одной точке.

Целевой характер инструмента MAIA позволяет проводить регулярные многоугольные наблюдения за глобально распределенным набором исследовательских участков. Подвес продольного (сканирования) имеет диапазон движения ± 58 градусов, в то время как поперечный (панорамированный) стабилизатор имеет диапазон движения ± 39 градусов, что в сумме с полем поперечного сечения ± 9 градусов. обзора обеспечивает поперечное поле обзора ± 48 градусов.Возможность панорамирования позволяет получить доступ к целям, которые не находятся непосредственно на траектории полета космического корабля, что позволяет наблюдать каждую цель в среднем не менее трех раз в неделю. Изображения одной и той же области можно наблюдать под разными углами обзора в последовательности «шаг-и-взгляд». Также возможен режим «развертки», при котором карданный вал сканирования непрерывно перемещается в доступном диапазоне.

Для большинства целей изображения будут получены с использованием пошагово-пристального режима (рис.2). В этом режиме стабилизаторы ориентируют камеру так, чтобы видеть переднюю кромку цели, начиная с наиболее наклонного переднего угла обзора. Снимки с перемычкой получают, пока камера остается зафиксированной под этим углом, после чего карданный вал сканирования перемещается к следующему (меньшему) углу обзора вперед, и изображения той же области повторно снимаются. Эта последовательность повторяется до тех пор, пока наблюдения не будут получены под всеми заданными углами. Привод панорамирования компенсирует вращение Земли между видами. Наблюдение под пятью углами обзора дало бы длину цели> 330 км с орбиты 600 км и> 420 км с орбиты 850 км.Число углов обзора можно выбрать, при этом большее количество углов приводит к более короткому расстоянию вдоль трассы, видимому для всех видов. В надире конструкция камеры покрывает поперечную полосу обзора 192 км на высоте орбиты 600 км, увеличиваясь до 272 км на высоте 850 км. Даже на самой низкой высоте целевые размеры охватывают крупные мегаполисы. Размеры зоны покрытия составляют порядка 200 м в надире и увеличиваются с увеличением угла обзора, особенно в продольном направлении. На максимальной высоте орбиты и наиболее наклонном угле обзора размер следа вдоль трассы остается ниже 1100 м, а выборка передискретизируется в 4 раза.5 в результате высокой частоты кадров.

Рис. 2

Пример последовательности шагов и взгляда MAIA, показывающий случай пяти дискретных углов обзора.

3.2.4.

Приборная система

Концептуальная схема прибора MAIA показана на рис. 3. Цилиндрический корпус служит радиатором для отвода тепла от электроники камеры. Другой радиатор, установленный для наблюдения за глубоким космосом, рассеивает тепло из фокальной плоскости, которая пассивно охлаждается до 225 К, чтобы ограничить темновой ток в детекторах SWIR.Другие части инструмента включают в себя структурные опоры, двухосный карданный шарнир, электронику инструмента, бортовой калибратор (OBC) и темную мишень (DT). OBC состоит из стеклянного рассеивателя и массива проводных поляризаторов и освещается солнечным светом, когда космический корабль пересекает один из полюсов орбиты. DT - это светозащищенный резонатор для измерения темных уровней. Двухосный стабилизатор позволяет периодически направлять камеру на эти калибраторы, а полученные данные используются при обработке наземных данных для обновления поляриметрических калибровок и калибровок смещения темноты.

Рис. 3

Концептуальная схема прибора MAIA.

3.3.

Science Operations

MAIA должен быть выведен на низкую солнечно-синхронную полярную орбиту на высоте от 600 до 850 км. Высота орбиты и среднее местное время пересечения экватора будут установлены после выбора основного космического корабля. Время перехода от середины до позднего утра является предпочтительным, чтобы учесть выгорание тумана и перемешивание пограничного слоя, а также потому, что утром ожидается меньше облаков, чем днем. 83 Кроме того, поскольку доступная область в поле обзора прибора увеличивается с высотой орбиты, частота повторных посещений цели обычно увеличивается с увеличением высоты орбиты. НАСА планирует выбрать космический корабль-хозяин в конце 2018 года, а запуск ожидается не ранее середины 2021 года. Базовая продолжительность миссии - 3 года.

Научные данные будут собираться в среднем по одной цели на орбиту, что дает около 100 съемок в неделю. Типичный объем данных прибора для каждой цели оценивается в 29 Гбит, что немного больше, чем объем, генерируемый MISR на одной орбите, несмотря на то, что MAIA наблюдает дискретные цели, в то время как MISR непрерывно наблюдает за освещенной стороной Земли.Это результат большего количества спектральных полос в MAIA, сбора поляриметрических данных и использования бортового пространственного усреднения в MISR. Первичные целевые районы (PTA) - крупные населенные пункты, предназначенные для проведения эпидемиологических исследований Научной группой MAIA. ПТА будут наблюдаться в пошаговом режиме, и они будут выбраны для включения крупных населенных пунктов, охватывающих диапазон концентраций ТЧ и типов частиц; поверхностные аэрозольные солнечные фотометры (например, от AERONET 45 ) для валидации поиска аэрозолей; Мониторы массы, размера и химического состава ТЧ, связанные с различными измерительными сетями 84 , 85 , чтобы обеспечить возможность разработки регрессионных моделей статистического и машинного обучения, которые связывают извлеченные интегрированные по столбцам свойства аэрозолей с приповерхностными ТЧ; и данные о состоянии здоровья, геокодированные по домашним адресам, почтовым индексам, группам переписи населения или аналогичным местоположениям субъектов исследования.Вторичные целевые области (STA) представляют собой регионы, представляющие интерес с точки зрения качества воздуха или других исследований аэрозолей и облаков (например, науки о климате), и в них может использоваться либо пошаговый режим, либо режим развертки в зависимости от цели измерения. STA не предъявляют тех же требований к доступности наземных мониторов, что и PTA, и возможность обработки данных более высокого уровня, помимо создания калиброванных и георектированных изображений (см. § 3.4.1), будет оцениваться в каждом конкретном случае. Целевые области калибровки / валидации (CVTA) будут регулярно наблюдаться для калибровки прибора и мониторинга стабильности, а также для валидации аэрозолей / ТЧ.Поскольку прибор MAIA не содержит абсолютного радиометрического калибратора, предварительная калибровка камеры будет регулярно обновляться посредством дополнительных калибровок в Railroad Valley, штат Невада. Метод косвенной калибровки широко применяется во многих исследованиях спутниковых датчиков и использует измерения поверхности и атмосферы, полученные во время пролета спутника, для расчета яркости верхней части атмосферы и обновления радиометрического отклика прибора. Наблюдения MAIA неинструментированных, но устойчивых земных целей, таких как пустыня Ливия-4, также будут использоваться для поддержания погрешности радиометрической калибровки в пределах ± 4% над яркими целями (± 6% над темными целями).Подходящий набор PTA, STA и CVTA показан на рис. 4. Специализированные съемки по возможным целям могут быть получены во время эпизодических событий, таких как извержения вулканов, крупные лесные пожары или пыльные бури.

Рис. 4

Набор кандидатов PTA, STA, CVTA и репрезентативных городов.

Кандидаты в PTA и STA, показанные на рис. 4, включают исторически малоизученные территории (например, Африка). Список подлежит обновлению в будущем, поскольку возможность наблюдения за некоторыми целями будет зависеть от высоты орбиты космического корабля-носителя, а переговоры о доступе к необходимым наземным мониторам и данным о состоянии здоровья все еще продолжаются.

3.4.

Обработка данных и продукты

Продукты данных MAIA следуют иерархии НАСА от уровня 0 (необработанные данные приборов) до уровня 1 (калиброванные и георективируемые изображения), уровня 2 (геофизические продукты в том же месте, что и исходные данные уровня 1) и уровень 4 (интеграция измеренных и смоделированных результатов). Поскольку пространственная привязка и картографическая проекция включены в обработку уровня 1 аналогично тому, как это делается для MISR, 86 MAIA не идентифицирует отдельные продукты уровня 3.Программное обеспечение для обработки данных, разработанное в центре научных вычислений MAIA в JPL (с алгоритмическими подходами и программным обеспечением, частично унаследованным от проектов MISR и AirMSPI), будет доставлено в NASA Langley ASDC для создания продукта.

3.4.1.

Калиброванные и георективируемые изображения уровня 1

Калиброванные и георективируемые изображения уровня 1 будут проецироваться на карту на высоту поверхности местности для получения пошаговых изображений и на эллипсоид поверхности для наблюдений с разверткой.Для тех целевых областей, которые будут подвергаться высокоуровневой обработке аэрозолей и ТЧ, алгоритм на основе дерева решений, основанный на опыте MISR и MODIS 87 - 89 , будет использоваться в оперативном режиме для обнаружения покрытых облаками пикселей.

3.4.2.

Аэрозоль уровня 2

Концепция обработки аэрозолей MAIA уровня 2 предусматривает использование алгоритма нелинейной оптимизации для настройки свойств аэрозоля в соответствии с полным набором многоугольных, мультиспектральных и поляриметрических данных, предоставляемых прибором MAIA.Этот алгоритм был прототипирован с использованием данных AirMSPI. 90 Для MAIA приемлемые пределы микрофизических и оптических свойств аэрозоля могут быть получены путем настройки CTM на региональном уровне и анализа климатологии аэрозолей для каждого PTA. Предварительно установленная база данных BRF на поверхности, основанная на алгоритме многоугловой реализации атмосферной коррекции (MAIAC) 91 , 92 , будет еще больше ограничивать поиск. Для стабилизации алгоритма будут наложены ограничения на пространственные и спектральные вариации свойств аэрозоля в соседних пикселях и временные вариации свойств отражения поверхности 76 , 90 в течение нескольких дней после повторных посещений цели.База данных поверхности MAIAC, которая была проверена на наличие облаков, потенциально добавляет дополнительный слой защиты от облаков. 93 Этот подход приводит к извлечению как общего AOD, так и дробного AOD, связанных с мелкими, крупными, сферическими, несферическими, поглощающими и непоглощающими аэрозолями на сетке 1 км. Прогнозируемые отношения сигнал / шум (SNR) в полосах, используемых для извлечения аэрозолей, находятся в диапазоне приблизительно от 190 до 880 над темными целями (коэффициент отражения от поверхности в наихудшем случае ∼0,02).Были определены требования к шумовым характеристикам, чтобы ограничить влияние случайного инструментального шума на извлечение и обеспечить SNR, аналогичные тем, которые достигаются с MISR.

3.4.3.

Уровень 2 PM

На следующем этапе процесса извлечения полученные общие и дробные AOD преобразуются в массовые концентрации PM10, PM2,5 и основных компонентов PM2,5, включая сульфаты, нитраты, OC, BC или EC и минералы. пыль. Отчетность о BC или EC зависит от типа наземного монитора, доступного в данном PTA.Пыль относится к ресуспендированным неорганическим материалам, таким как почва, дорожная пыль, строительная пыль или летучая зола. Существует несколько ключевых различий между продуктами AOD уровня 2 и PM, которые необходимо учитывать при этом преобразовании. Во-первых, AOD - это величина, интегрированная в столбец, тогда как для изучения воздействия переносимых по воздуху ТЧ на здоровье человека наибольший интерес представляют частицы вблизи поверхности. Во-вторых, концентрации PM обычно указываются при контролируемой относительной влажности (RH), тогда как MAIA AODs соответствуют окружающей RH.В-третьих, эпидемиологов интересует средняя концентрация ТЧ за 24-часовой период, в то время как спутник MAIA пролетает над своими целями в определенное время суток. Наконец, физические и оптические характеристики частиц, захваченных в полях АОТ, лишь косвенно связаны с химическим составом.

Преобразования от общего и дробного AOD во время пролета спутника к усредненной за 24 часа общей массе PM и фракциям частиц PM, если они получены исключительно на основе только наблюдений MAIA, вероятно, будут сопряжены с систематическими ошибками и погрешностями.Однако предыдущие исследования показали, что модели геостатистической регрессии (GRM), полученные из AOD, дробного AOD и других атрибутов окружающей среды, таких как температура, относительная влажность, скорость ветра, тип земного покрова и вид аэрозолей с вертикальным разрешением из CTM, а также совместно размещенные измерения с наземных мониторов, могут использоваться для эмпирической калибровки спутниковых данных в местах, где наземные мониторы отсутствуют, и для учета различий в том, как определяются продукты AOD и PM. 53 , 94 - 96 Исследуется ансамблевой подход к генерации GRM с использованием как байесовской структуры, так и различных методологий машинного обучения, например, искусственных нейронных сетей, опорных векторных машин и случайных леса. 97 , 98

Для создания карт уровня 2 специфических PM2,5 MAIA будет опираться на текущую практику и включать данные мониторов видообразования PM в дополнение к тем, которые измеряют общее PM2.5 и PM10 при создании GRM. Источники таких данных включают Сеть химического анализа (CSN) и сеть межведомственного мониторинга защищенных визуальных сред (IMPROVE), сеть 84 Surface Particulate mAtter Network (SPARTAN), 85 другие существующие мониторы в PTA и дополнительные наземные мониторы для быть развернутым проектом MAIA. Текущие планы состоят в том, чтобы расширить сеть SPARTAN с помощью пробоотборников на основе фильтров в MAIA PTA. Чтобы справиться с задержкой в ​​несколько месяцев, связанной с доступностью данных CSN, IMPROVE и SPARTAN, для генерации промежуточных данных будут использоваться среднемесячные доли видов за тот же месяц в предыдущие годы, дополненные вспомогательной информацией, такой как температура и относительная влажность. оценки специфицированных PM2.5 в местах расположения мониторов. Как только фактические данные станут доступны, продукты MAIA уровня 2 будут переработаны.

Также рассматривается вопрос о развертывании недорогих датчиков частиц на основе рассеяния света, таких как PurpleAir (PA) 99 , в дополнение к существующим сетям PM2,5 и PM10, спонсируемым государством. Полевые и лабораторные испытания, проведенные Центром оценки характеристик датчиков качества воздуха (AQ-SPEC) Южного побережья Управления качеством воздуха (SCAQMD), показывают, что, хотя PA имеет тенденцию переоценивать массу ТЧ, обнаружена высокая степень корреляции с эталонными методами EPA, 100 включение коррекции систематических смещений в данных PA.JPL развернула несколько датчиков PA (предоставленных SCAQMD) в Бейкерсфилде, Фресно и Визалии, Калифорния, для дальнейшей оценки.

3.4.4.

Уровень 4, заполненный пробелами PM

Карты уровня 2 PM заполняются данными только в тех случаях, когда были сгенерированы извлечения аэрозолей, экранированные облаками с использованием данных прибора MAIA. Кроме того, карты уровня 2 не создаются в дни, когда нет спутниковых эстакад. Для генерации пространственных и временных оценок воздействия ТЧ с заполненными пробелами, которые необходимы для эпидемиологических исследований, проект MAIA планирует производить ежедневный продукт уровня 4 PM с заполненными пробелами, в котором пространственные пробелы из-за облачности или других выпадений заполняются и PM оценки производятся в непревышенные дни.Три источника данных служат в качестве входных данных для создания этого продукта: продукт ТЧ на основе приборов уровня 2, интерполированные карты, созданные на основе измерений монитора поверхности, и массовые и фракционные концентрации ТЧ, предсказанные CTM. Полный пространственный и временной охват для каждого PTA может быть получен путем объединения данных спутниковых извещений, измерений концентрации на уровне земли и выходных данных CTM в пост-поисковой обработке.

Предполагается, что оценки PM уровня 4 будут средневзвешенными, определяемыми относительной прогностической способностью каждого входного источника.Веса могут варьироваться в зависимости от пространства и времени и выводятся из оценок неопределенности, связанных с каждым из входных данных. Неопределенности, связанные со спутниковым продуктом уровня 2, будут генерироваться как часть алгоритма поиска. Интерполированные значения с наземных мониторов будут наиболее точными для местоположений и моментов времени, ближайших к положению монитора и периоду выборки, и высокая неопределенность будет назначена там, где географические факторы, такие как изменения высоты поверхности, сделают интерполяцию ненадежной.Для CTM MAIA планирует использовать мезомасштабную модель исследования и прогнозирования погоды в сочетании с моделью химии (WRF-Chem), 101 , 102 в сочетании с выбросами дыма от лесных пожаров из системы определения местоположения пожаров и моделирования горящих выбросов 103 и вложена в глобальную модель состава атмосферы GEOS-Chem, основанную на метеорологических наблюдениях системы наблюдений за Землей Годдарда. 104 Выходные данные WRF-Chem будут генерироваться на сетке 4 км, а GEOS-Chem - на сетке 25 км.Чтобы учесть систематические ошибки, которые, как известно, поражают даже самые современные CTM, выходные данные 105 WRF-Chem будут улучшаться на протяжении всей миссии с использованием статистики выходных данных модели, которая анализируется путем сравнения с картами и данными PM, указанными MAIA уровня 2. с наземных мониторов. Например, недавнее исследование 106 откалибровало выходные данные GEOS-Chem с использованием данных мониторинга видообразования в сочетании с метеорологическими переменными и переменными землепользования с использованием нейронной сети обратного распространения, которая позволяет создавать сложные и нелинейные ассоциации между входными данными модели.Эта модель использовалась для прогнозирования суточных массовых концентраций PM2,5 и компонентов в уменьшенной сетке размером 1 км. Точность прогнозов оценивалась с помощью перекрестной проверки в k-кратном размере. Среднее значение общего R2 на отключенных мониторах составляло 0,85, 0,71, 0,69, 0,83 и 0,81 для PM2,5, EC, OC, нитрата и сульфата соответственно.

Как и в случае с MISR, за архивирование и распространение продуктов данных MAIA отвечает ASDC. В целях защиты частной жизни ни один из общедоступных продуктов геофизических данных, созданных в ходе расследования MAIA и хранящихся в ASDC, не будет содержать никаких данных о состоянии здоровья.Медицинские записи, к которым имеют доступ эпидемиологи и эксперты в области общественного здравоохранения из группы MAIA, будут обрабатываться в соответствии с четко установленными юридическими и этическими требованиями в отношении конфиденциальности, защиты конфиденциальности и безопасности данных.

3.5.

Научные исследования

Различные эпидемиологические исследования запланированы для различных ЗВП MAIA в зависимости от преобладающих присутствующих видов PM, типа имеющихся медицинских записей и предыдущих исследований воздействия загрязнения воздуха в каждой области.Будут использоваться хорошо зарекомендовавшие себя эпидемиологические методологии, такие как временные ряды, перекрестный анализ случаев и когортные исследования 107 - 109 .

Информация о возможном наборе PTA (см. Рис. 4) показана в таблице 2. Научная группа MAIA планирует сосредоточить внимание на последствиях для здоровья, связанных с диапазоном концентраций PM и различными временными масштабами воздействия. Острое воздействие происходит в течение нескольких дней и обычно связано с преждевременной смертностью и частым посещением больниц из-за сердечно-сосудистых и респираторных заболеваний.Эти исследования проводятся путем анализа записей статистики естественного движения населения (например, свидетельств о смерти) и записей о госпитализации или посещениях отделения неотложной помощи. Исследования субхронического воздействия в первую очередь нацелены на исходы родов и осложнения беременности, такие как низкая масса тела при рождении и преэклампсия. Эти результаты обычно исследуются путем анализа записей о рождении, содержащихся в данных статистики естественного движения населения региона, или путем определения когорты новорожденных. Исследования хронического воздействия обычно отслеживают последствия для здоровья на индивидуальном уровне в течение нескольких лет и важны, поскольку они документируют увеличение риска заболеваемости и смертности и часто используются в оценках ГББ.Обычно это делается с помощью установленной когорты или путем анализа существующих медицинских карт в сочетании с данными о долгосрочном проживании. 111

Таблица 2

Характеристики кандидатов в ПТС.

91 x 1 EVHPAZ 0091-6765 Google Scholar

66.

R. D. Peng et al., «Неотложная госпитализация при сердечно-сосудистых и респираторных заболеваниях и химический состав загрязнения воздуха мелкими частицами», Environ.Перспектива здоровья., 117 957 –963 (2009). https://doi.org/10.1289/ehp.0800185 EVHPAZ 0091-6765 Google Scholar

67.

J. A. Sarnat et al., «Источники мелких частиц и кардиореспираторная заболеваемость: применение химического баланса массы и факторных аналитических методов распределения источников», Environ. Перспектива здоровья., 116 459 –466 (2008). https://doi.org/10.1289/ehp.10873 EVHPAZ 0091-6765 Google Scholar

69.

H.Джетва и О. Торрес, «Полученные со спутников данные о зависящем от длины волны поглощении аэрозолей в дыме от сжигания биомассы, полученные с помощью инструмента мониторинга озона», Атмос. Chem. Phys., 11 10541 –10551 (2009). https://doi.org/10.5194/acp-11-10541-2011 ACPTCE 1680-7324 Google Scholar

73.

N. Ferlay et al., «К новым выводам о структурах облаков на основе разнонаправленных измерений в полосе кислорода А: давление в середине облака и геометрическая толщина облака по данным POLDER-3 / PARASOL», Дж.Прил. Meteorol. Климатол., 49 2492 –2507 (2010). https://doi.org/10.1175/2010JAMC2550.1 Google Scholar

74.

О. П. Хасекамп и Дж. Ландграф, «Извлечение свойств аэрозоля над земной поверхностью: возможности измерения интенсивности и поляризации с несколькими углами обзора», Прил. Опт., 46 3332 –3344 (2007). https://doi.org/10.1364/AO.46.003332 APOPAI 0003-6935 Google Scholar

76.

Дубовик О. и др., «Статистически оптимизированный алгоритм инверсии для улучшенного восстановления свойств аэрозоля из спектральных многоугловых поляриметрических спутниковых наблюдений», Атмос.Измер. Тех., 4975 –1018 (2011). https://doi.org/10.5194/amt-4-975-2011 Google Scholar

77.

Калашникова О.В. и др., «Фотополяриметрическая чувствительность к содержанию черного углерода в дыму лесных пожаров: результаты полевой кампании 2016 года ImPACT-PM», J. Geophys. Рес.-Атмос., 123 5376 –5396 (2018). https://doi.org/10.1029/2017JD028032 Google Scholar

85.

G. Snider et al., «СПАРТАН: глобальная сеть для оценки и улучшения спутниковых оценок приземных твердых частиц для глобальных приложений здравоохранения», Атмос.Измер. Тех., 8 505 –521 (2015). https://doi.org/10.5194/amt-8-505-2015 Google Scholar

89.

Янг, Л. Ди Джироламо и Д. Маццони, «Выбор автоматического алгоритма пороговой обработки для маски облаков с радиометрической камерой спектро-радиометра с многоугольным изображением», Remote Sens. Environ., 107 159 –171 (2007). https://doi.org/10.1016/j.rse.2006.05.020 Google Scholar

90.

F. Xu et al., «Совместное извлечение свойств аэрозоля и отражения от поверхности земли с помощью бортового многоугольного спектрополяриметрического формирователя изображения (AirMSPI)», Дж.Geophys. Рес.-Атмос., 122 7004 –7026 (2017). https://doi.org/10.1002/2017JD026776 Google Scholar

94.

I. Kloog et al., «Включение местной регрессии землепользования и оптической глубины спутникового аэрозоля в гибридную модель пространственно-временного воздействия PM2,5 в штатах средней Атлантики», Environ. Sci. Технол., 46 11913 –11921 (2012). https://doi.org/10.1021/es302673e ESTHAG 0013-936X Google Scholar

96.

X. Hu et al., «10-летние пространственные и временные тренды концентраций PM2,5 на юго-востоке США, оцененные с использованием спутниковых данных высокого разрешения», Атмос. Chem. Физ., 14 6301 –6314 (2014). https://doi.org/10.5194/acp-14-6301-2014 ACPTCE 1680-7324 Google Scholar

98.

Х. Х. Чанг, Х. Ху и Ю. Лю, «Калибровка оптической толщины аэрозоля MODIS для прогнозирования суточных концентраций PM2,5 посредством статистического уменьшения масштаба», J. Expos. Sci. Environ. Эпидемиол., 24 398 –404 (2013).https://doi.org/10.1038/jes.2013.90 Google Scholar

101.

J. D. Fast et al., «Эволюция прямого воздействия озона, твердых частиц и аэрозолей в городских районах с использованием новой полностью связанной модели метеорологии, химии и аэрозолей», J. Geophys. Res.-Atmos., 111 D21305 (2006). https://doi.org/10.1029/2005JD006721 Google Scholar

103.

J. S. Reid et al., «Глобальный мониторинг и прогнозирование дыма от сжигания биомассы: описание и уроки программы определения местоположения пожара и моделирования горящих выбросов (FLAMBE)», IEEE J.Sel. Темы Прил. Earth Observ. Датч. Сенс., 2144 –162 (2009). https://doi.org/10.1109/JSTARS.2009.2027443 Google Scholar

105.

Y. Zhang et al., «Исследование регионального загрязнения озоном и твердыми частицами в Соединенных Штатах: 1. 1-летнее моделирование и оценка CMAQ с использованием наземных и спутниковых данных», J. Geophys. Res.-Atmos., 114 D22304 (2009). https://doi.org/10.1029/2009JD011898 Google Scholar

109.

К.Дж. Ротман, С. Гренландия и Т. Л. Лэш, Современная эпидемиология, 3-е изд. Липпинкотт Уильямс и Уилкинс, Филадельфия, Пенсильвания (2008). Google Scholar

111.

D. L. Crouse et al., «Риск неслучайной и сердечно-сосудистой смертности в связи с долгосрочным воздействием низких концентраций мелких твердых частиц: когортное исследование на национальном уровне в Канаде», Environ. Перспектива здоровья., 120 708 –714 (2012). https://doi.org/10.1289/ehp.1104049 Google Scholar

114.

T. F. Mar et al., «Распределение источников ТЧ и воздействие на здоровье. 3. Изучение различий между методами в связи между предполагаемым источником выбросов PM2,5 и ежедневной смертностью в Фениксе, штат Аризона », J. Exposure Sci. Environ. Эпидемиол., 16 311 –320 (2005). https://doi.org/10.1038/sj.jea.7500465 Google Scholar

116.

S. M. Gilboa et al., «Связь между качеством окружающего воздуха и отдельными врожденными дефектами, исследование Seven County, Техас, 1997–2000», Являюсь.J. Epidemiol., 162 238 –252 (2005). https://doi.org/10.1093/aje/kwi189 AJEPAS 0002-9262 Google Scholar

119.

E. H. van den Hooven et al., «Воздействие загрязнения воздуха во время беременности, ультразвуковые измерения роста плода и неблагоприятные исходы родов: проспективное когортное исследование», Environ. Перспектива здоровья., 120150 –156 (2012). https://doi.org/10.1289/ehp.1003316 EVHPAZ 0091-6765 Google Scholar

120.

Н. Гувейя, С.А. Бремнер и Х. М. Д. Новаес, «Связь между загрязнением окружающего воздуха и массой тела при рождении в Сан-Паулу, Бразилия», J. Epidemiol. Commun. Здоровье, 58 11 –17 (2004). https://doi.org/10.1136/jech.58.1.11 JECHDR 0141-7681 Google Scholar

122.

B. Ritz et al., «Исследование загрязнения окружающего воздуха и преждевременных родов в окружающей среде и исходов беременности в Калифорнийском университете в Лос-Анджелесе», Являюсь. J. Epidemiol., 166 1045 –1052 (2007).https://doi.org/10.1093/aje/kwm181 Google Scholar

123.

B. Hoffman et al., «Хроническое воздействие загрязнения воздуха твердыми частицами и маркерами системного воспаления в жилых помещениях», Environ. Перспектива здоровья., 117 1302 –1308 (2009). https://doi.org/10.1289/ehp.0800362 EVHPAZ 0091-6765 Google Scholar

128.

R. C. Puett et al., «Хроническое воздействие твердых частиц, смертность и ишемическая болезнь сердца в исследовании здоровья медсестер», Являюсь.J. Epidemiol., 168 1161 –1168 (2008). https://doi.org/10.1093/aje/kwn232 AJEPAS 0002-9262 Google Scholar

132.

I. Kloog et al., «Новая гибридная пространственно-временная модель для оценки суточных многолетних концентраций PM2,5 на северо-востоке США с использованием данных оптической глубины аэрозолей с высоким разрешением», Атмос. Окружающая среда, 95 581 –590 (2014). https://doi.org/10.1016/j.atmosenv.2014.07.014 AENVEQ 0004-6981 Google Scholar

Биография

Дэвид Дж.Дайнер - старший научный сотрудник Лаборатории реактивного движения Калифорнийского технологического института. Он получил степень бакалавра физики в Государственном университете Нью-Йорка в Стоуни-Брук и степень магистра и доктора наук в области планетологии в Калифорнийском технологическом институте. Он является главным исследователем MISR, AirMSPI, AirMSPI-2 и MAIA. Его исследовательские интересы включают атмосферную оптику, разработку приборов дистанционного зондирования и влияние аэрозолей на качество воздуха и климат.

Стейси В.Боланд - системный инженер проекта MAIA в JPL. Она получила степень бакалавра физики в Техасском университете в Далласе и степень магистра и доктора наук в области машиностроения в Калифорнийском технологическом институте. Она руководила многочисленными исследованиями концепций миссий и приборов и является членом Руководящего комитета Десятилетнего обзора наук о Земле и космических приложений за 2017 год.

Майкл Брауэр - профессор Школы здоровья населения Университета Британской Колумбии и аффилированный профессор Института показателей и оценки здоровья Вашингтонского университета.Он получил степень бакалавра биохимии и экологических наук в Калифорнийском университете в Беркли и докторскую степень в области гигиены окружающей среды в Гарварде. Он является советником Всемирной организации здравоохранения и членом основной аналитической группы по глобальному бремени болезней.

Кэрол Брюгге - член технического персонала JPL, специализирующийся на калибровке приборов. Она получила степени бакалавра и магистра прикладной физики в Калифорнийском университете в Сан-Диего, а также степень магистра и доктора наук в области оптических наук в Университете Аризоны.Она является главным исследователем автоматизированного испытательного полигона для калибровки в пустыне в Рейлроуд-Вэлли, штат Невада, а также членом Комитета по спутникам наблюдения Земли.

Кевин А. Берк - менеджер проекта MAIA в JPL. Он получил степень бакалавра машиностроения в Корнельском университете и степень магистра делового администрирования в области предпринимательства и финансов в Школе менеджмента Андерсона Калифорнийского университета в Лос-Анджелесе. Он специализируется на проектировании механических систем и ранее был менеджером по доставке продукции на марсоходе Mars Curiosity и менеджером по полетным системам в проекте сверхзвуковых замедлителей низкой плотности.

Рассел Чипман - профессор оптики в Университете Аризоны и приглашенный профессор Центра оптических исследований и образования (CORE) Университета Уцуномия, Япония. Он получил степень бакалавра физики в Массачусетском технологическом институте и степень магистра и доктора наук в области оптических наук в Университете Аризоны. Он специализируется на инженерии поляризационной оптики и сотрудничал с JPL при проектировании и разработке приборов AirMSPI и AirMSPI-2.

Ларри Ди Джироламо - профессор Блу Уотерс на факультете атмосферных наук Университета Иллинойса в Урбана-Шампейн.Он получил степень бакалавра астрофизики в Королевском университете в Кингстоне и степень магистра и доктора наук в области атмосферных и океанических наук в Университете Макгилла. Он использует свой опыт в разработке масок облаков и валидации аэрозолей и облаков в научных группах MISR и MODIS.

Майкл Дж. Гарай - научный сотрудник Лаборатории реактивного движения, имеющий опыт в области переноса излучения, разработки алгоритмов извлечения аэрозолей и облаков и валидации для MISR. Он получил степень бакалавра английской литературы и степень бакалавра физики в университете Толедо и степень магистра атмосферных наук в Калифорнийском университете в Лос-Анджелесе.

Сина Хашеминассаб - специалист по качеству воздуха в отделе развития науки и технологий в районе управления качеством воздуха Южного побережья, обладающий опытом в области мониторинга качества воздуха с использованием пробоотборников на месте и моделирования распределения источников атмосферных ТЧ. Он получил степень бакалавра химической инженерии в Технологическом университете Шарифа (Тегеран, Иран) и степень магистра и доктора наук в области экологической инженерии в Университете Южной Калифорнии.

Эдвард Хайер - физик в Лаборатории военно-морских исследований в Монтерее, Калифорния. Он получил степень бакалавра химии и социологии в колледже Гоучер, а также степень магистра и доктора географии в Университете Мэриленда. Он участвует в разнообразных исследованиях, связанных с наблюдением и моделированием пожаров и дыма, и является ведущим разработчиком системы обнаружения пожаров и мониторинга выбросов от горения (FLAMBE).

Майкл Джеррет - профессор и председатель Школы общественного здравоохранения Филдинга Калифорнийского университета в Лос-Анджелесе.Он получил степень бакалавра наук об окружающей среде в Университете Трент, а также степень магистра и доктора наук в области политологии окружающей среды и географии, соответственно, в Университете Торонто. Он специализируется в области воздействия на здоровье человека, связанного с загрязнением воздуха, и включения продуктов спутниковых данных в оценки воздействия ТЧ.

Велько Йованович - старший член технического персонала и руководитель технической группы JPL, обладающий опытом геометрической калибровки и цифровой фотограмметрии.Он получил степень бакалавра инженерных наук в области геодезии в Белградском университете и степень магистра геоматики в Университете Пердью. Он возглавляет разработку системы научных данных MAIA, а также является заместителем руководителя проекта MISR.

Ольга В. Калашникова - научный сотрудник Лаборатории реактивного движения, в основном работает над приложениями теории рассеяния частиц и данными дистанционного зондирования для картирования свойств аэрозолей с использованием MISR и AirMSPI. Она получила степень бакалавра физики в Казахском государственном национальном университете и степень магистра физики и докторскую степень в области астрофизики, планетологии и атмосферы в Университете Колорадо в Боулдере.

Ян Лю - доцент Школы общественного здравоохранения Роллинза при Университете Эмори. Он получил степень бакалавра наук об окружающей среде и инженерии в Университете Цинхуа, степень магистра машиностроения в Калифорнийском университете и докторскую степень в области наук об окружающей среде и инженерии в Гарварде. Он разработал модели воздействия PM2,5, используя данные аэрозолей, полученные от MISR, MODIS и других спутниковых инструментов, и применил результаты к исследованиям воздействия на здоровье.

Алексей И. Ляпустин - научный сотрудник Центра космических полетов имени Годдарда НАСА. Он получил степени бакалавра и магистра в МГУ, а также докторскую степень в Институте космических исследований, Москва, Россия. Он является экспертом в области дистанционного зондирования аэрозолей и двунаправленного отражения от поверхности земли от спутниковых датчиков, теории переноса излучения с газовым поглощением и поляризацией, а также является ведущим разработчиком алгоритма многоугловой реализации атмосферной коррекции (MAIAC).

Рэндалл В. Мартин - профессор, заведующий кафедрой передовых исследований Артура Б. Макдональда в Университете Далхаузи и научный сотрудник Смитсоновской астрофизической обсерватории. Он получил степень бакалавра инженерных наук в Корнелле, степень магистра наук об окружающей среде в Оксфорде, а также степень магистра и доктора технических наук в Гарварде. Он является главным исследователем Сети приземных частиц (SPARTAN) и руководит производством спутниковых PM2.5 оценок глобального бремени болезней.

Эбигейл Настан - системный инженер-программист в JPL, специализируется на разработке приложений, научных коммуникациях и работе с общественностью. Она получила степень магистра планетологии в Калифорнийском технологическом институте и степень бакалавра наук в области международных геолого-геофизических исследований в Университете Монтаны.

Барт Д. Остро в настоящее время работает эпидемиологом-экологом в Калифорнийском университете в Дэвисе.До этого он был начальником отдела эпидемиологии загрязнения воздуха Калифорнийского агентства по охране окружающей среды. Он получил сертификат штата Калифорния по экологической эпидемиологии и докторскую степень по экономике в Университете Брауна. Он принимал участие в установлении стандартов качества воздуха и проведении эпидемиологических исследований по всему миру.

Беате Ритц - профессор эпидемиологии в Школе общественного здравоохранения Филдинга при Калифорнийском университете в Лос-Анджелесе, а также в области наук о здоровье окружающей среды и неврологии в Калифорнийском университете в Лос-Анджелесе.Она получила степень доктора медицины и докторскую степень в области медицинской социологии в Гамбургском университете, а также степень магистра здравоохранения и докторскую степень по эпидемиологии в Калифорнийском университете в Лос-Анджелесе. Ее основные исследования сосредоточены на загрязнении воздуха, неблагоприятных исходах родов и здоровье детей.

Джоэл Шварц - профессор экологической эпидемиологии в T.H. Chan School of Public Health Гарвардского университета. Он получил докторскую степень в области теоретической физики в Университете Брандейс и докторскую степень в Базельском университете. Его исследования сосредоточены на воздействии загрязнения воздуха на здоровье, новых методологиях построения временных рядов и пересечения случаев, а также на разработке геопространственных моделей загрязнения воздуха с использованием спутниковых данных (MODIS и MISR).

Цзюнь Ван - профессор инженерного колледжа Университета Айовы. Он получил степень бакалавра в области динамики атмосферы в Нанкинском метеорологическом институте, степень магистра в области мезомасштабного моделирования в Институте физики атмосферы Китайской академии наук и докторскую степень в области атмосферных наук в Университете Алабамы-Хантсвилля. Он изучал качество воздуха PM с помощью комбинации спутниковых данных (включая MODIS и MISR), GEOS-Chem и WRF-Chem.

Фэн Сюй - научный сотрудник JPL, где он разрабатывал алгоритмы для определения свойств связанных аэрозолей и нижних границ и создавал их прототипы для MAIA с использованием данных MISR и AirMSPI. Он получил степень бакалавра в области теплотехники и степень магистра машиностроения в Шанхайском университете науки и технологий, а также докторскую степень по физике в Руанском университете.

Глубокое размножение микробов на границе базальтов в океанической коре возрастом 33,5–104 миллиона лет

Участки отбора проб

Образцы керна были собраны из базальтового фундамента на участках U1365, U1367 и U1368 в Южно-Тихоокеанском круговороте во время комплексного морского бурения Программа (IODP) Экспедиция 329 (с 9 октября по 13 декабря 2010 г .; дополнительный рис.1 и дополнительная таблица 1). Хотя данные о поверхностном тепловом потоке с участков U1365 и U1367 соответствовали ожидаемым для проводящей коры в отсутствие адвекции, данные с участка U1368 показали существенно низкий тепловой поток, что указывает на очевидные потери тепла и адвективную циркуляцию вышележащей морской воды в океанической коре ( Экспедиция 329 ученых, 2011г). Мощность осадочного покрова колебалась от 6 м до 71 м (дополнительная таблица 1). Молекулярный кислород (O 2 ) и нитраты проникают через толщу отложений из вышележащей морской воды в базальтовый фундамент, поскольку скорость накопления отложений настолько низка, что обломочное органическое вещество в значительной степени окисляется на морском дне, а скорость диффузии O 2 превышает скорость диффузии органических скорость окисления в более глубоко захороненных отложениях (дополнительный рис.1 и дополнительная таблица 1).

Бурение и петрологическое описание керна базальтов

Образцы базальта были получены с использованием системы отбора керна с вращающимся керном (RCB) из скважин U1365E, U1367F и U1368F. Хотя загрязнение керна RCB буровыми растворами на основе морской воды неизбежно, его степень можно тщательно контролировать. После каждого извлечения керна все секции керна немедленно перемещались с подиума в холодную камеру на трюмной палубе бурового исследовательского судна JOIDES Resolution.Перед отбором микробиологических проб визуально производилось предварительное описание петрологических характеристик. Прошло от 8 до 18 часов до последующего микробиологического отбора образцов горных пород в холодильной камере. Буровые растворы и морскую воду собирали на каждом участке и хранили при -80 ° C для анализа ДНК.

Минералогические и микробиологические характеристики шлифов базальтовых кернов

Для уточнения минерального состава и микробного распределения в трещинах горных пород были приготовлены шлифы в соответствии с протоколом, установленным для локализации эндосимбиотических клеток у хемосинтезирующих животных 39 .Образцы керна с трещинами дважды дегидратировали в 100% этаноле в течение 5 минут, а образцы керна четыре раза пропитывали LR white (London Resin Co. Ltd., Олдермастон, Англия) в течение 30 минут и затвердевали в печи при 50 ° C. на 48 ч. Затвердевшие блоки разрезались на тонкие шлифы и полировались корундовым порошком и алмазной пастой. Для окрашивания микробных клеток, заключенных в LR white, на тонкие срезы наносили TE-буфер с SYBR Green I (TaKaRa). После инкубации в темноте в течение 5 минут тонкие срезы промывали деионизированной водой, закрепляли антифатическим реагентом VECTASHIELD (Vector Laboratories, Burlingame, CA, USA), а затем наблюдали с помощью конфокального лазерного сканирующего микроскопа (IX71 с системой FLUOVIEW 300; Olympus). или эпифлуоресцентный микроскоп (BX51; Olympus).Два диапазона флуоресценции от 540 нм до 570 нм и от 570 нм до 600 нм использовались, чтобы отличить микробные клетки от сигналов флуоресценции, специфичных для минералов.

Минеральные ассоциации и текстуры наблюдались с помощью оптического микроскопа (BX51; Olympus) и камеры с зарядовой связью (CCD) (DP71; Olympus). Тонкие срезы с углеродным покрытием были охарактеризованы с помощью сканирующего электронного микроскопа (S4500; Hitachi, Ibaraki, Japan) при ускоряющем напряжении 15 кВ. Получение изображений обратно-рассеянных электронов в сочетании с энергодисперсионной рентгеновской спектроскопией (EDS) использовалось для анализа химического состава минеральных фаз в соответствии с контрастами изображений.

Для анализа микробных клеток, обнаруженных в трещинах горных пород, с помощью наноразмерной масс-спектрометрии вторичных ионов (NanoSIMS) в Институте исследования образцов керна Кочи, JAMSTEC (NanoSIMS 50 L; CAMECA; AMETEK Co. Ltd., Женневилье, Франция), 3 мкм- толстые срезы были изготовлены с использованием методики пробоподготовки FIB с использованием прибора Hitachi FB-2100 (Hitachi) с системой микровыбора проб. Тонкий срез был локально покрыт слоем W (толщиной 100–500 нм) для защиты и обрезан пучком ионов Ga при ускоряющем напряжении 30 кВ.

Элементарные изображения C, O и N в виде CN, Si, P, S и FeO из образца тонкого среза FIB были получены с помощью ионного изображения с использованием ионного микрозонда NanoSIMS 50 L. Сфокусированный первичный ионный пучок Cs + ~ 1.0 пА (диаметр пучка 100 нм) был растрирован на образцах 12 × 12 мкм 2 для U1365-12R2 и 16 × 16 мкм 2 для U1365-8R4. Вторичные ионы 12 C, 16 O, 12 C 14 N - , 28 Si - , 31 P - , 32 S - и 54 Fe 16 O - были получены одновременно с множественным детектированием с использованием семи электронных умножителей с разрешающей способностью по массе ~ 4500.Каждый запуск запускался после стабилизации интенсивности вторичного ионного пучка после предварительного распыления в течение <~ 2 мин с относительно сильным током первичного ионного пучка (~ 20 пА). Каждый прогон визуализации многократно сканировался (20 раз) по одной и той же области с отдельными изображениями размером 256 × 256 пикселей. Время выдержки составляло 10000 мкс / пиксель для измерений, а общее время сбора данных составляло ~ 3 часа. Изображения были обработаны с использованием программного обеспечения NASA JSC для обработки изображений NanoSIMS, разработанного программой Interactive Data Language 40 .

После анализа NanoSIMS 50 L срезы толщиной 3 мкм были дополнительно утонены до толщины 100 нм для исследования с использованием просвечивающего электронного микроскопа JEOL JEM-ARM200F (JEOL, Токио, Япония), работающего при ускоряющем напряжении 200 кВ на Кочинский институт исследования керна JAMSTEC. Рентгеновские элементные карты были получены с использованием EDS с кремниевым дрейфовым детектором 2 диаметром 100 мм и программным обеспечением JEOL Analysis Station 3.8 (JEOL) в режиме сканирующей просвечивающей электронной микроскопии (STEM).Просвечивающий электронный микроскоп JEOL 2010, оборудованный EDS в Токийском университете, также использовался для получения спектров EDS из срезов толщиной 100 нм.

Контроль загрязнения

Для контроля загрязнения использовались флуоресцентные микросферы (диаметром 0,5 мкм). Этот подход не является количественным, но предоставляет доказательства наличия причастного загрязнения даже во внутренних структурах базальтовых образцов (например, микротрещинах и прожилках). На первом этапе мешок с флуоресцентными микросферами помещали на улавливатель керна каждого керна, и после извлечения керна и отбора проб все микробиологические образцы проверяли на наличие микросфер.

Процедуры, связанные с оценкой и уменьшением загрязнения бурового раствора, схематически проиллюстрированы на дополнительном рисунке 1. Загрязнение первоначально исследовалось на необработанной поверхности путем удаления небольших кусков породы с помощью стерилизованного пламенем молотка и долота. Удаленную поверхность породы замачивали в 25 мл 3% раствора NaCl, и микросферы, суспендированные в растворе NaCl, собирали в центрифужной пробирке на 50 мл. Эта процедура необходима для подтверждения воздействия микросфер на керны во время бурения.Поверхность породы дважды промывали 25 мл 3% -ного раствора NaCl в стерильном пластиковом пакете. Небольшие кусочки вымытой наружной поверхности удаляли стерилизованным пламенем молотком и долотом, а промывные растворы собирали в центрифужной пробирке на 50 мл. После этапа промывки поверхность горной породы постоянно обжигали пропановой горелкой (то есть, при постоянном времени воздействия и расстоянии между пламенем и поверхностью ядра). Обожженная порода была взломана с помощью стерилизованного пламенем молотка и долота, и небольшие части изнутри и снаружи были отдельно пропитаны 25 мл 3% раствора NaCl с последующим объединением растворов в центрифужную пробирку объемом 50 мл.Для подсчета микросфер 3 мл аликвот фильтровали с использованием 25-миллиметровых черных поликарбонатных фильтров (размер пор 0,22 мкм) и исследовали под эпифлуоресценцией с помощью микроскопа Olympus BX51 (Olympus, Токио, Япония). Минимальный предел обнаружения был определен как ~ 100 микросфер / см 3 породы на основе среднего значения ± стандартное отклонение (SD) пяти повторных измерений холостого счета ( n = 5).

Анализ состава сообщества

Прокариотическая ДНК была выделена из 0.1 г порошкового внутреннего ядра 41 , замороженного при -80 ° C для хранения. Буровые растворы, собранные на каждой буровой площадке и хранящиеся при -80 ° C, также были подвергнуты экстракции ДНК. В 300 мкл щелочного раствора (pH 13,5; 75 мкл 0,5 N NaOH и 75 мкл буфера TE) порошкообразные образцы керна инкубировали при 65 ° C в течение 30 минут, а затем аликвоты центрифугировали при 5000 × 9 · 1082 г для 30 с. После центрифугирования супернатант переносили в новую пробирку и нейтрализовали добавлением 150 мкл 1 М трис-HCl (pH 6.5). ДНК-несущий раствор (pH 7,0–7,5) концентрировали с помощью осаждения холодным этанолом, осадок ДНК растворяли в 50 мкл буфера ТЕ и хранили при -4 ° C или -20 ° C для более длительного хранения. Экстракцию ДНК из подвыборок проводили параллельно с одним отрицательным контролем экстракции, к которому не добавляли образец. Отрицательный контроль также подвергали пиросеквенированию.

Область гена 16S рРНК длиной 378 п.н. амплифицировали с использованием праймеров Uni530F и Uni907R для пиросеквенирования с использованием секвенатора GS FLX System 42 (Roche Applied Science, Penzberg, Германия).Праймеры были расширены последовательностями адаптера (Uni530F: CCATCTCATCCCTGCGTGTCTCCGACTCAG; и Uni907: CCTATCCCCTGTGTGCCTTGGCAGTCTCAG). Прямой праймер Uni530 был закодирован штрих-кодом с 8-мерными олигонуклеотидами для получения последовательностей из множества образцов за один цикл 43 . Термический цикл был выполнен с 30 циклами денатурации при 95 ° C в течение 30 с, отжига при 54 ° C в течение 30 с и удлинения при 74 ° C в течение 30 с. Ампликон ожидаемого размера с помощью полимеразной цепной реакции (ПЦР) вырезали из 1.5% гели агарозы после электрофореза и очистки с использованием набора для экстракции гелей MinElute (Qiagen, Валенсия, Калифорния, США). Концентрации ДНК очищенных ампликонов ПЦР измеряли с помощью флуорометра Qubit с набором для анализа дцДНК HS Quant-iT (Invitrogen, Карлсбад, Калифорния, США). Концентрацию общей дцДНК в каждом образце доводили до 5 нг / мкл. ПЦР эмульсии выполняли с использованием набора GS FLX Titanium emPCR Lib-L (Roche Applied Science) для обогащения гранул библиотеки ДНК для секвенатора системы GS FLX.Амплифицированные фрагменты ДНК секвенировали в соответствии с инструкциями производителя (Roche Applied Science).

Необработанные чтения были демультиплексированы, обрезаны и отфильтрованы на основе их 8-битных последовательностей тегов, специфичных для выборки, а значения качества и длины были назначены с помощью команды clsplitseq в программе MOTHUR 44 . Отфильтрованные последовательности были удалены на основе кластеризации последовательностей, и, возможно, химерные последовательности были обнаружены и удалены с помощью программы MOTHUR. Отобранные считывания были согласованы с использованием эталонного набора данных Greengenes или базы данных SILVA 128 и алгоритма Нидлмана-Вунша в программе MOTHUR.Чтобы отнести последовательности к филотипам в качестве операционных таксономических единиц (OTU), был использован алгоритм кластеризации соседей с использованием программы MOTHUR с отсечкой сходства последовательностей 97%. Используя «веганский» пакет в R 45 , неметрические графики многомерного масштабирования были получены для филотипов, сгруппированных с 97% сходством. Кроме того, кластеризация и анализ тепловых карт микробных сообществ были проанализированы с использованием «веганского» пакета в R 45 . Филогенетическая принадлежность филотипов была проанализирована вместе с близкородственными последовательностями, полученными из GenBank (http: // www.ncbi.nlm.nih.gov/genbank/) посредством поиска BLASTn (несколько похожих последовательностей) с использованием метода объединения соседей в программном пакете ARB 46 . Алгоритм быстрой начальной загрузки (500 копий начальной загрузки) в программном пакете ARB был затем использован для оценки шаблонов ветвления в деревьях соединения соседей.

μ-Рамановская спектроскопия

Рамановские спектры минералов, заполняющих трещины, были получены с использованием 50-сантиметрового одиночного полихроматорного спектрографа для визуализации изображений (Bruker Optics, Осака, Япония), который был оснащен оптическим микроскопом (BX51; Olympus), Ar + лазер (514.5 нм, 5500 А; International Light Technologies, Пибоди, Массачусетс, США) и камеру CCD (1024 × 256 пикселей; DU401A-BR-DD; Andor Technology, Белфаст, Ирландия). Падающий лазер работал на 20 мВт, а пространственное разрешение составляло ~ 1 мкм. Для удаления линии Рэлея использовался обрезной фильтр. Рамановские линии нафталина при 513,6 см −1 , 763,5 см −1 , 1021,3 см −1 , 1147,3 см −1 , 1382,3 см −1 , 1464,3 см −1 и 1576,3 см -1 использовались для калибровки рамановского сдвига.Аналитическая неопределенность обычно составляла ~ 1 см -1 . Для анализа железосодержащих фаз был вставлен недисперсионный фильтр, снижающий интенсивность лазерного луча на ~ 10%, чтобы избежать индуцированного лучом превращения гетита в гематит.

Характеристики органического углерода глинистых фракций базальтовых кернов

Части кернов горных пород, исследованные, как описано выше, были измельчены в порошок с помощью ступки и пестика. Фракции размером с глину в порошкообразных образцах суспендировали в дистиллированной и деионизированной воде, центрифугировали при 3000 об / мин в течение 5 мин, а затем собирали супернатант.Затем глинистую фракцию собирали из надосадочной жидкости центрифугированием при 10000 об / мин в течение 10 минут и сушили при 50 ° C, а затем подвергали анализу органического углерода. Гранулы KBr, изготовленные из глинистых фракций, анализировали с помощью спектрометрии с преобразованием Фурье в инфракрасных лучах (FT-IR) (Perkin Elmer Spectrum 2000, Tokyo, Japan) для выяснения липидов в существующих микроорганизмах. Таблетки в камере для образцов, заполненной газом N 2 , анализировались инфракрасными лучами через светоделитель KBr с детектором MCT.Репрезентативные ИК-Фурье спектры получали путем усреднения 100 индивидуальных спектров. Содержание органического углерода в глинистых фракциях измеряли с помощью масс-спектрометра (Thermo Electron DELTAplus Advantage; Thermo Fisher Scientific Inc., Уолтем, Массачусетс), подключенного к элементному анализатору (EA1112, Thermo Electron DELTAplus Advantage) через интерфейс Conflo III. Глинистые фракции нагревали при 100 ° C в 3% HCl для удаления карбонатных минералов, дважды промывали дистиллированной деионизированной водой и сушили.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета об исследовании природы, связанном с этой статьей.

Регулирование воспаления антиоксидантной гемоксигеназой 1

  • 1.

    Паоли, М., Марлес-Райт, Дж. И Смит, А. Взаимосвязи между структурой и функцией гем-белков. DNA Cell Biol. 21 , 271–280 (2002).

    CAS PubMed Статья PubMed Central Google Scholar

  • 2.

    Kumar, S. & Bandyopadhyay, U. Токсичность свободного гема и его системы детоксикации у человека. Toxicol. Lett. 157 , 175–188 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 3.

    Гоззелино Р., Джени В. и Соарес М. П. Механизмы защиты клеток гемоксигеназой-1. Annu. Rev. Pharmacol. Toxicol. 50 , 323–354 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 4.

    Тенхунен Р., Марвер Х. С. и Шмид Р. Ферментативное превращение гема в билирубин микросомальной гемоксигеназой. Proc. Natl Acad. Sci. США 61 , 748–755 (1968).

    CAS PubMed Статья PubMed Central Google Scholar

  • 5.

    Синглтон, Дж. У. и Ластер, Л. Биливердин редуктаза печени морской свинки. J. Biol. Chem. 240 , 4780–4789 (1965).

    CAS PubMed Статья PubMed Central Google Scholar

  • 6.

    Ямагути Т., Комода Ю. и Накадзима Х. Альфа-редуктаза биливердин-IX и бета-редуктаза биливердин-IX из печени человека. Очистка и характеристика. J. Biol. Chem. 269 , 24343–24348 (1994).

    CAS PubMed Статья PubMed Central Google Scholar

  • 7.

    Тракшел, Г. М., Кутти, Р. К. и Мэйнс, М. Д. Очистка и характеристика основной конститутивной формы гемоксигеназы яичек.Неприводимая изоформа. J. Biol. Chem. 261 , 11131–11137 (1986).

    CAS PubMed Статья PubMed Central Google Scholar

  • 8.

    Мейн, М. Д., Тракшел, Г. М. и Кутти, Р. К. Характеристика двух конститутивных форм микросомальной гемоксигеназы печени крысы. Индуцируется только один молекулярный вид фермента. J. Biol. Chem. 261 , 411–419 (1986).

    CAS PubMed Статья PubMed Central Google Scholar

  • 9.

    Мейн, М. Д. Система гемоксигеназы: регулятор вторичных газов-посредников. Annu. Rev. Pharmacol. Toxicol. 37 , 517–554 (1997).

    CAS PubMed Статья PubMed Central Google Scholar

  • 10.

    Верма А., Хирш Д., Глатт К., Роннетт Г. и Снайдер С. Окись углерода: предполагаемый нейронный мессенджер. Наука 259 , 381–384 (1993).

    CAS PubMed Статья PubMed Central Google Scholar

  • 11.

    Maines, M. D. & Kappas, A. Индукция кобальтом гемоксигеназы печени; с доказательствами того, что цитохром P-450 не важен для активности этого фермента. Proc. Natl Acad. Sci. США 71 , 4293–4297 (1974).

    CAS PubMed Статья PubMed Central Google Scholar

  • 12.

    Оттербейн, Л., Сильвестр, С. Л. и Чой, А. М. Гемоглобин обеспечивает защиту от летальной эндотоксемии у крыс: роль гемоксигеназы-1. Am. J. Respir. Cell Mol. Биол. 13 , 595–601 (1995).

    CAS PubMed Статья PubMed Central Google Scholar

  • 13.

    Otterbein, L.E. et al. Экзогенное введение гемоксигеназы-1 путем переноса гена обеспечивает защиту от повреждения легких, вызванного гипероксией. J. Clin. Вкладывать деньги. 103 , 1047–1054 (1999).

    CAS PubMed PubMed Central Статья Google Scholar

  • 14.

    Ли, Т.-С. И Чау, Л.-Й. Гемоксигеназа-1 опосредует противовоспалительный эффект интерлейкина-10 у мышей. Nat. Med. 8 , 240–246 (2002). Одно из самых ранних исследований по установлению противовоспалительной роли HO-1, эта статья сообщает, что IL-10 активирует HO-1 в макрофагах мыши и опосредует защитные эффекты IL-10 в модели in vivo липополисахарид-индуцированного септический шок .

    CAS PubMed Статья PubMed Central Google Scholar

  • 15.

    Otterbein, L.E. et al. Окись углерода обладает противовоспалительным действием, включая путь митоген-активируемой протеинкиназы. Nat. Med. 6 , 422–428 (2000). Это важное раннее исследование, демонстрирующее противовоспалительное действие монооксида углерода на in vivo модели септического шока, вызванного липополисахаридами .

    CAS PubMed Статья PubMed Central Google Scholar

  • 16.

    Poss, K. D. & Tonegawa, S. Снижение защиты от стресса в клетках с дефицитом гемоксигеназы 1. Proc. Natl Acad. Sci. США 94 , 10925–10930 (1997).

    CAS PubMed Статья PubMed Central Google Scholar

  • 17.

    Радхакришнан Н. и др. Дефицит гемоксигеназы-1 человека проявляется гемолизом, нефритом и аспленией. J. Pediatr. Гематол. Онкол. 33 , 74–78 (2011).

    CAS PubMed Статья PubMed Central Google Scholar

  • 18.

    Kapturczak, M.H. et al. Гемоксигеназа-1 модулирует ранние воспалительные реакции: данные мышей с дефицитом гемоксигеназы-1. Am. J. Pathol. 165 , 1045–1053 (2004). Эта знаковая статья является первой, в которой описан провоспалительный фенотип, наблюдаемый у Hmox1 - / - мышей .

    CAS PubMed PubMed Central Статья Google Scholar

  • 19.

    Yachie, A. et al. Окислительный стресс вызывает усиленное повреждение эндотелиальных клеток при дефиците гемоксигеназы-1 человека. J. Clin. Вкладывать деньги. 103 , 129–135 (1999). Это первое исследование по выявлению дефицита HO-1 у людей, демонстрирующее усиление воспалительной реакции .

    CAS PubMed PubMed Central Статья Google Scholar

  • 20.

    Immenschuh, S. & Ramadori, G. Генная регуляция гемоксигеназы-1 как терапевтическая мишень. Biochem. Pharmacol. 60 , 1121–1128 (2000).

    CAS PubMed Статья PubMed Central Google Scholar

  • 21.

    Феррандиз М. Л. и Девеса И. Индукторы гемоксигеназы-1. Curr. Pharm. Des. 14 , 473–486 (2008).

    CAS PubMed Статья PubMed Central Google Scholar

  • 22.

    Эпплгейт, Л. А., Люшер, П. и Тиррелл, Р. М. Индукция гемоксигеназы: общий ответ на оксидантный стресс в культивируемых клетках млекопитающих. Cancer Res. 51 , 974–978 (1991).

    CAS PubMed PubMed Central Google Scholar

  • 23.

    Ма, Q. Роль Nrf2 в окислительном стрессе и токсичности. Annu. Rev. Pharmacol. Toxicol. 53 , 401–426 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 24.

    Кансанен, Э., Куосманен, С. М., Лейнонен, Х. и Левонен, А.-Л. Путь Keap1-Nrf2: механизмы активации и нарушения регуляции при раке. Редокс Биол. 1 , 45–49 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 25.

    Тагучи, К., Мотохаши, Х. и Ямамото, М. Молекулярные механизмы пути Keap1-Nrf2 в стрессовой реакции и развитии рака. Genes Cell 16 , 123–140 (2011).

    CAS Статья Google Scholar

  • 26.

    Sun, J. et al. Гемопротеин Bach2 регулирует доступность энхансера гена гемоксигеназы-1. EMBO J. 21 , 5216–5224 (2002).

    CAS PubMed PubMed Central Статья Google Scholar

  • 27.

    Zenke-Kawasaki, Y. et al. Гем вызывает убиквитинирование и деградацию фактора транскрипции Bach2. Мол. Клетка. Биол. 27 , 6962–6971 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 28.

    Suzuki, H. et al. Гем регулирует экспрессию генов, запуская Crm1-зависимый ядерный экспорт Bach2. EMBO J. 23 , 2544–2553 (2004).

    CAS PubMed PubMed Central Статья Google Scholar

  • 29.

    Liao, R. et al. Открытие того, как гем контролирует функцию генома с помощью гемомики. Cell Rep. 31 , 107832 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 30.

    Mense, S. M. & Zhang, L. Heme: универсальная сигнальная молекула, контролирующая активность различных регуляторов, от факторов транскрипции до киназ MAP. Cell Res. 16 , 681–692 (2006).

    CAS PubMed Статья PubMed Central Google Scholar

  • 31.

    Zhang, X. et al. Bach2: функция, регуляция и участие в болезни. Оксид. Med. Клетка. Longev. 2018 , 1347969 (2018).

    PubMed PubMed Central Google Scholar

  • 32.

    Kataoka, K. et al. Малые белки Maf гетеродимеризуются с Fos и могут действовать как конкурентные репрессоры фактора транскрипции NF-E2. Мол. Клетка. Биол. 15 , 2180–2190 (1995).

    CAS PubMed PubMed Central Статья Google Scholar

  • 33.

    Lee, P. J. et al. Индуцируемый гипоксией фактор-1 опосредует активацию транскрипции гена гемоксигеназы-1 в ответ на гипоксию. J. Biol. Chem. 272 , 5375–5381 (1997).

    CAS PubMed Статья PubMed Central Google Scholar

  • 34.

    Лавровский Ю., Шварцман М. Л., Левере Р. Д., Каппас А. и Абрахам Н. Г. Идентификация сайтов связывания для факторов транскрипции NF-kappa B и AP-2 в промоторной области гена гемоксигеназы 1 человека. Proc. Natl Acad. Sci. США 91 , 5987–5991 (1994).

    CAS PubMed Статья PubMed Central Google Scholar

  • 35.

    Алам, Дж. И Кук, Дж. Л. Сколько факторов транскрипции необходимо для включения гена гемоксигеназы-1? Am.J. Respir. Cell Mol. Биол. 36 , 166–174 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 36.

    Zhang, Z., Guo, Z., Zhan, Y., Li, H. & Wu, S. Роль ацетилирования гистонов в активации связанного с ядерным фактором эритроид 2 пути фактора 2 / гемоксигеназы 1 хлоридом марганца. Toxicol. Прил. Pharmacol. 336 , 94–100 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 37.

    Magalhães, M. et al. Метилирование ДНК в генах-модификаторах тяжести заболевания легких изменяется при муковисцидозе. Clin. Эпигенетика 9 , 19 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 38.

    Ray, P. D., Huang, B. W. & Tsuji, Y. Скоординированная регуляция Nrf2 и фосфорилирования серина 10 гистона h4 в активируемой арсенитом транскрипции гена гемоксигеназы-1 человека. Biochim. Биофиз. Acta Gene Regul. Мех. 1849 , 1277–1288 (2015).

    CAS Статья Google Scholar

  • 39.

    Медина, М. В., Сапочник, Д., Гарсиа Сола, М. и Косо, О. Регулирование экспрессии гемоксигеназы-1: передача сигнала, активация промотора гена и т. Д. Антиоксид. Редокс-сигнал. 32 , 1033–1044 (2019).

    Артикул CAS Google Scholar

  • 40.

    Cheng, X., Ku, C.-H. И Сиоу, Р. С. М. Регулирование антиоксидантного пути Nrf2 с помощью микроРНК: новые игроки в микроменеджменте окислительно-восстановительного гомеостаза. Free Radic. Биол. Med. 64 , 4–11 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 41.

    Lin, C.-C. и другие. Трансформирующий фактор роста-β1 стимулирует экспрессию гемоксигеназы-1 через пути PI3K / Akt и NF-κB в эпителиальных клетках легких человека. Eur. J. Pharmacol. 560 , 101–109 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 42.

    Martin, D. et al. Регулирование экспрессии гемоксигеназы-1 через путь фосфатидилинозитол-3-киназы / Akt и фактор транскрипции Nrf2 в ответ на фитохимический антиоксидант карнозол. J. Biol. Chem. 279 , 8919–8929 (2004).

    CAS PubMed Статья PubMed Central Google Scholar

  • 43.

    Seo, S. H. & Jeong, G. S. Физетин ингибирует TNF-альфа-индуцированное воспалительное действие и индуцированное перекисью водорода окислительное повреждение в клетках HaCaT кератиноцитов человека посредством PI3K / AKT / Nrf-2-опосредованной экспрессии гемоксигеназы-1. Внутр. Иммунофармакол. 29 , 246–253 (2015).

    CAS PubMed Статья PubMed Central Google Scholar

  • 44.

    Ricchetti, G.A., Williams, L.M. и Foxwell, B.Экспрессия M. J. Hemexygenase 1, индуцированная IL-10, требует STAT-3 и фосфоинозитол-3 киназы и ингибируется липополисахаридом. J. Leukoc. Биол. 76 , 719–726 (2004).

    CAS PubMed Статья PubMed Central Google Scholar

  • 45.

    Cho, R.-L. и другие. Индукция гемоксигеназы-1 розиглитазоном через путь PKCα / AMPKα / p38 MAPKα / SIRT1 / PPARγ подавляет опосредованное липополисахаридом воспаление легких. Biochem. Pharmacol. 148 , 222–237 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 46.

    Liu, X. et al. Активация AMPK стимулирует экспрессию гена гемоксигеназы-1 и выживание эндотелиальных клеток человека. Am. J. Physiol. Circ. Physiol. 300 , H84 – H93 (2011).

    CAS Статья Google Scholar

  • 47.

    Mo, C. et al. Перекрестные помехи между сигнальными путями Nrf2 и AMPK важны для противовоспалительного действия берберина на LPS-стимулированных макрофагах и мышей, подвергшихся шоку эндотоксина. Антиоксид. Редокс-сигнал. 20 , 574–588 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 48.

    Кэмпбелл, Н. К., Фитцджеральд, Х. К., Флетчер, Дж. М. и Данн, А. Полифенолы растительного происхождения модулируют метаболизм дендритных клеток человека и иммунную функцию посредством AMPK-зависимой индукции гемоксигеназы-1. Фронт. Иммунол. 10 , 345 (2019). Эта статья определяет важную связь между центральным регулятором иммунометаболизма, AMPK, и HO-1 .

    CAS PubMed PubMed Central Статья Google Scholar

  • 49.

    Zimmermann, K. et al. Активированный AMPK усиливает сигнальную ось Nrf2 / HO-1 - роль в реакции развернутого белка. Free Radic. Биол. Med. 88 , 417–426 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 50.

    Joo, M. S. et al. AMPK способствует накоплению Nrf2 в ядре путем фосфорилирования серина 550. Мол. Клетка. Биол. 36 , 1931–1942 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 51.

    Балделли С., Аквилано К. и Чириоло М.R. Punctum на двух разных факторах транскрипции, регулируемых PGC-1α: ядерном факторе, производном от эритроидного 2-подобного 2, и ядерном респираторном факторе 2. Biochim. Биофиз. Acta Gen. Subj. 1830 , 4137–4146 (2013).

    CAS Статья Google Scholar

  • 52.

    Takagi, T. et al. Повышенная кишечная экспрессия гемоксигеназы-1 и ее локализация у пациентов с язвенным колитом. J. Gastroenterol.Гепатол. 23 , S229 – S233 (2008).

    CAS PubMed Статья PubMed Central Google Scholar

  • 53.

    Paul, G. et al. Анализ кишечной гемоксигеназы-1 (HO-1) при клинических и экспериментальных колитах. Clin. Exp. Иммунол. 140 , 547–555 (2005).

    CAS PubMed PubMed Central Статья Google Scholar

  • 54.

    Fagone, P. et al. Экспрессия гемоксигеназы-1 в мононуклеарных клетках периферической крови коррелирует с активностью заболевания при рассеянном склерозе. J. Neuroimmunol. 261 , 82–86 (2013). Это исследование демонстрирует связь между экспрессией HO-1 и тяжестью заболевания у пациентов с рассеянным склерозом .

    CAS PubMed Статья PubMed Central Google Scholar

  • 55.

    Wegiel, B. et al.Окись углерода, производная гемоксигеназы-1, способствует созреванию миелоидных клеток. Cell Death Dis. 5 , e1139 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 56.

    Найто Ю., Такаги Т. и Хигашимура Ю. Гемоксигеназа-1 и противовоспалительные макрофаги М2. Arch. Биохим. Биофиз. 564C , 83–88 (2014).

    Артикул CAS Google Scholar

  • 57.

    Recalcati, S. et al. Дифференциальная регуляция гомеостаза железа при поляризованной активации макрофагов человека. Eur. J. Immunol. 40 , 824–835 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 58.

    Каир, Г., Рекалкати, С., Мантовани, А. и Локати, М. Торговля железом и метаболизм в макрофагах: вклад в поляризованный фенотип. Trends Immunol. 32 , 241–247 (2011).

    CAS PubMed Статья PubMed Central Google Scholar

  • 59.

    Винн, Н. К., Волк, К. М. и Хасти, А. Х. Регулирование тканевого гомеостаза железа: макрофаг «ферростат». JCI Insight 5 , e132964 (2020).

    PubMed Central Статья Google Scholar

  • 60.

    Виджаян, В., Wagener, F. A. D. T. G. и Immenschuh, S. Система макрофагов гем-гем оксигеназа-1 и ее роль в воспалении. Biochem. Pharmacol. 153 , 159–167 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 61.

    Boyle, J. J. et al. Активация фактора транскрипции 1 направляет атеропротекторные макрофаги Mhem посредством скоординированного обращения с железом и защиты пенных клеток. Circ.Res. 110 , 20–33 (2012).

    CAS PubMed Статья PubMed Central Google Scholar

  • 62.

    Orozco, L. D. et al. Экспрессия гемоксигеназы-1 в макрофагах играет важную роль в развитии атеросклероза. Circ. Res. 100 , 1703–1711 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 63.

    Zhang, M. et al. Миелоид HO-1 модулирует поляризацию макрофагов и защищает от ишемического реперфузионного повреждения. JCI Insight 3 , e120596 (2018).

    PubMed Central Статья Google Scholar

  • 64.

    Camhi, SL, Alam, J., Wiegand, GW, Chin, BY & Choi, AMK Транскрипционная активация гена HO-1 липополисахаридом опосредуется 5'-дистальными энхансерами: роль реактивных кислородных промежуточных соединений и АП-1. Am. J. Respir. Cell Mol. Биол. 18 , 226–234 (1998).

    CAS PubMed Статья PubMed Central Google Scholar

  • 65.

    Immenschuh, S., Stritzke, J., Iwahara, SI & Ramadori, G. Повышающая регуляция экспрессии гена гемсвязывающего белка 23 (HBP23) липополисахаридом опосредуется через зависимый от оксида азота сигнальный путь в клетках Купфера крыс. Гепатология 30 , 118–127 (1999).

    CAS PubMed Статья PubMed Central Google Scholar

  • 66.

    Tzima, S., Victoratos, P., Kranidioti, K., Alexiou, M. & Kollias, G. Миелоидная гемоксигеназа-1 регулирует врожденный иммунитет и аутоиммунитет путем модуляции продукции IFN-β. J. Exp. Med. 206 , 1167–1179 (2009).

    CAS PubMed PubMed Central Статья Google Scholar

  • 67.

    Onyiah, J. C. et al. Окись углерода и гемоксигеназа-1 предотвращают воспаление кишечника у мышей, способствуя удалению бактерий. Гастроэнтерология 144 , 789–798 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 68.

    Соарес, М. П. и Хамза, И. Макрофаги и метаболизм железа. Иммунитет 44 , 492–504 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 69.

    Халл Т. Д., Агарвал А. и Джордж Дж. Ф. Система мононуклеарных фагоцитов в гомеостазе и заболевании: роль гемоксигеназы-1. Антиоксид. Редокс-сигнал. 20 , 1770–1788 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 70.

    Waltz, P. et al. Липополисахарид индуцирует аутофагическую передачу сигналов в макрофагах через TLR4, путь, зависимый от гемоксигеназы-1. Аутофагия 7 , 315–320 (2011).

    CAS PubMed Статья PubMed Central Google Scholar

  • 71.

    Jais, A. et al. Гемоксигеназа-1 вызывает метафламу и инсулинорезистентность у мышей и людей. Ячейка 158 , 25–40 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 72.

    Kimura, S. et al. Увеличение количества макрофагов, экспрессирующих гемоксигеназу-1, указывает на тенденцию к плохому прогнозу при распространенном колоректальном раке. Пищеварение 101 , 401–410 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 73.

    Чау, Л. Ю. Гемоксигеназа-1: новая цель терапии рака. J. Biomed. Sci. 22 , 22 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 74.

    Миттерстиллер, А.M. et al. Гемоксигеназа 1 контролирует ранний врожденный иммунный ответ макрофагов на инфекцию Salmonella Typhimurium. Cell. Microbiol. 18 , 1374–1389 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 75.

    Scharn, C. R. et al. Гемоксигеназа-1 регулирует воспаление и выживаемость микобактерий в макрофагах человека во время инфицирования микобактериями туберкулеза. J. Immunol. 196 , 4641–4649 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 76.

    Carasi, P. et al. Экспрессия гемоксигеназы-1 способствует иммунорегуляции, индуцированной фасциолой гепатика, и способствует инфекции. Фронт. Иммунол. 8 , 883 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 77.

    Moreau, A. et al. Толерогенные дендритные клетки активно ингибируют Т-клетки посредством гемоксигеназы-1 у грызунов и нечеловеческих приматов. FASEB J. 23 , 3070–3077 (2009).

    CAS PubMed Статья PubMed Central Google Scholar

  • 78.

    Chauveau, C. et al. Экспрессия гемоксигеназы-1 подавляет созревание дендритных клеток и провоспалительную функцию, но сохраняет экспрессию IL-10. Кровь 106 , 1694–1702 (2005). Это важное исследование является первым, описывающим конститутивную экспрессию HO-1 с помощью незрелых DCs и его подавление во время созревания DC .

    CAS PubMed Статья PubMed Central Google Scholar

  • 79.

    Listopad, J. et al. Гемоксигеназа-1 подавляет Т-клеточное воспаление кожи, дифференциацию и функцию антигенпрезентирующих клеток. Exp. Дерматол. 16 , 661–670 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 80.

    George, J. F. et al. Подавление CD4 + CD25 + регуляторными Т-клетками зависит от экспрессии гемоксигеназы-1 в антигенпрезентирующих клетках. Am. J. Pathol. 173 , 154–160 (2008).

    CAS PubMed PubMed Central Статья Google Scholar

  • 81.

    Schumacher, A. et al. Блокирование гемоксигеназы-1 отменяет защитный эффект регуляторных Т-клеток на беременность мышей и способствует созреванию дендритных клеток. PLoS ONE 7 , e42301 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 82.

    Campbell, N. K. et al. Индукторы гемоксигеназы 1 природного происхождения ослабляют воспалительные реакции в дендритных клетках и Т-клетках человека: актуальность для лечения псориаза. Sci. Отчет 8 , 10287 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 83.

    Аль-Хусейни, Л. М. А. и др. Гемоксигеназа-1 регулирует функцию дендритных клеток посредством модуляции передачи сигналов p38 MAPK-CREB / ATF1. J. Biol. Chem. 289 , 16442–16451 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 84.

    Wong, T.-H., Chen, H.-A., Gau, R.-J., Yen, J.-H. И Суен, Ж.-Л. Дендритные клетки, экспрессирующие гемоксигеназу-1, способствуют дифференцировке Foxp3 + регуляторных Т-клеток и вызывают менее тяжелое воспаление дыхательных путей на мышиных моделях. PLoS ONE 1 , 1–14 (2016). В этом исследовании сообщается, что мышиные ДК, кондиционированные для экспрессии HO-1, способствуют дифференцировке антиген-специфических клеток T reg как in vitro, так и in vivo и вызывают меньшее воспаление в модели астмы .

    Google Scholar

  • 85.

    Brück, J. et al. Пищевой контроль аутоиммунного заболевания, опосредованного IL-23 / Th27, посредством активации HO-1 / STAT3. Sci. Отчет 7 , 44482 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 86.

    Simon, T. et al. Ингибирование эффекторных антиген-специфических Т-клеток путем внутрикожного введения индукторов гемоксигеназы-1. J. Autoimmun. 81 , 44–55 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 87.

    Хора, А. A. et al. Гемоксигеназа – 1 и окись углерода подавляют аутоиммунное нейровоспаление. J. Clin. Вкладывать деньги. 117 , 438–447 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 88.

    Tardif, V. et al. Окись углерода уменьшает слияние эндосом и лизосом и ингибирует презентацию растворимого антигена дендритными клетками Т-клеткам. Eur. J. Immunol. 43 , 2832–2844 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 89.

    Rémy, S. et al. Окись углерода подавляет индуцированную TLR иммуногенность дендритных клеток. J. Immunol. 182 , 1877–1884 (2009).

    PubMed Статья CAS PubMed Central Google Scholar

  • 90.

    Riquelme, S. A., Pogu, J., Anegon, I., Bueno, S. M. & Kalergis, A. M. Окись углерода нарушает митохондриально-зависимое созревание эндосом и презентацию антигена в дендритных клетках. Eur. J. Immunol. 45 , 3269–3288 (2015).

    CAS PubMed Статья PubMed Central Google Scholar

  • 91.

    Basdeo, S.A. et al. Подавление аллореактивных Т-клеток человека линейными тетрапирролами; актуальность для трансплантации. Пер. Res. 178 , 81–94.e2 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 92.

    Pae, H.-O., Oh, G.-S., Choi, B.-M., Chae, S.-C. И Чанг, Х.-Т. Дифференциальная экспрессия гена гемоксигеназы-1 в субпопуляциях CD25- и CD25 + CD4 + Т-клеток человека. Biochem. Биофиз. Res. Commun. 306 , 701–705 (2003).

    CAS PubMed Статья PubMed Central Google Scholar

  • 93.

    Чой, Б. М., Пае, Х. О., Чон, Ю. Р., Ким, Ю. М. и Чунг, Х. Т. Критическая роль гемоксигеназы-1 в Foxp3-опосредованном подавлении иммунитета. Biochem. Биофиз. Res. Commun. 327 , 1066–1071 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 94.

    Ся, З.-В. и другие. Гемоксигеназа-1 ослабляет воспаление дыхательных путей, вызванное овальбумином, за счет активации Т-регуляторных клеток Foxp3, интерлейкина-10 и мембраносвязанного трансформирующего фактора роста-β1. Am. J. Pathol. 171 , 1904–1914 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 95.

    Zhang, Y., Zhang, L., Wu, J., Di, C. & Xia, Z. Гемоксигеназа-1 играет защитную роль в нейтрофильном воспалении дыхательных путей, вызванном овальбумином, путем ингибирования клеток Th27. опосредованный иммунный ответ. J. Biol. Chem. 288 , 34612–34626 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 96.

    Lin, X. L. et al. Гемоксигеназа-1 напрямую связывает STAT3, чтобы контролировать образование патогенных клеток Th27 во время нейтрофильного воспаления дыхательных путей. Eur. J. Allergy Clin. Иммунол. 72 , 1972–1987 (2017).

    CAS Статья Google Scholar

  • 97.

    Берт, Т. Д., Сеу, Л., Молд, Дж. Э., Каппас, А. и МакКьюн, Дж. М. Наивные человеческие Т-клетки активируются и пролиферируют в ответ на ингибитор гемоксигеназы-1 олова мезопорфирин. J. Immunol. 185 , 5279–5288 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 98.

    Zelenay, S., Chora, A., Soares, M. P. & Demengeot, J. Гемоксигеназа-1 не требуется для развития и функционирования регуляторных Т-клеток мыши. Внутр. Иммунол. 19 , 11–18 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 99.

    Chen, X. et al. Бутират натрия регулирует баланс клеток Th27 / Treg, улучшая увеит через путь Nrf2 / HO-1. Biochem. Pharmacol. 142 , 111–119 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 100.

    Zhang, L. et al. Гемоксигеназа-1 улучшает индуцированный декстрансульфатом натрия острый колит у мышей, регулируя баланс клеток Th27 / Treg. J. Biol. Chem. 289 , 26847–26858 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 101.

    Yu, M. et al. Высокая экспрессия гемоксигеназы-1 в органах-мишенях может ослабить острую реакцию «трансплантат против хозяина» за счет регуляции иммунного баланса Th27 / Treg. транспл. Иммунол. 37 , 10–17 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 102.

    О’Нил, Л. А. Дж., Киштон, Р. Дж. И Ратмелл, Дж. Руководство по иммунометаболизму для иммунологов. Nat. Rev. Immunol. 16 , 553–565 (2016).

    PubMed PubMed Central Статья CAS Google Scholar

  • 103.

    Wegiel, B., Nemeth, Z., Correa-Costa, M., Bulmer, A.C., Otterbein, L.E., гемоксигеназа-1: метаболический метод. Антиоксид. Редокс-сигнал. 20 , 1709–1722 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 104.

    Фигейредо-Перейра, К., Диас-Педросо, Д., Соарес, Н. Л. и Виейра, Х. Л. А. Цитопротекция, опосредованная CO, зависит от модуляции клеточного метаболизма. Редокс Биол. 32 , 101470 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 105.

    Park, J., Joe, Y., Ryter, S. W., Surh, Y. J. & Chung, H. T. Сходства и различия в эффектах метформина и монооксида углерода на иммунометаболизм. Мол. Ячейка 42 , 292–300 (2019).

    CAS Google Scholar

  • 106.

    Витек, Л. Роль билирубина при диабете, метаболическом синдроме и сердечно-сосудистых заболеваниях. Фронт. Pharmacol. 3 , 55 (2012).

    PubMed PubMed Central Статья Google Scholar

  • 107.

    Деннери, П. А. Оценка положительного и отрицательного воздействия желчных пигментов в раннем и более позднем возрасте. Фронт. Pharmacol. 3 , 1–5 (2012).

    Артикул Google Scholar

  • 108.

    Huang, J. et al. Железо регулирует гомеостаз глюкозы в печени и мышцах с помощью AMP-активируемой протеинкиназы у мышей. FASEB J. 27 , 2845–2854 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 109.

    Frezza, C. et al. Гемоксигеназа является синтетически смертельной для опухолевого супрессора фумаратгидратазы. Природа 477 , 225–228 (2011).

    CAS PubMed Статья PubMed Central Google Scholar

  • 110.

    Mills, E. L. et al. Итаконат - противовоспалительный метаболит, который активирует Nrf2 посредством алкилирования KEAP1. Природа 556 , 113–117 (2018). Это исследование идентифицирует метаболит итаконат как активатор NRF2 и индуктор HO-1 с иммуномодулирующим действием .

    CAS PubMed PubMed Central Статья Google Scholar

  • 111.

    Келли Б. и О’Нил Л. А. Перепрограммирование метаболизма в макрофагах и дендритных клетках при врожденном иммунитете. Cell Res. 25 , 771–784 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 112.

    Shi, L.Z. et al. HIF1α-зависимый гликолитический путь регулирует метаболическую контрольную точку для дифференцировки Th27 и Treg клеток. J. Exp. Med. 208 , 1367–1376 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 113.

    Finlay, D. K. et al. PDK1-регуляция mTOR и индуцируемого гипоксией фактора 1 объединяют метаболизм и миграцию CD8 + Т-клеток. J. Exp. Med. 209 , 2441–2453 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 114.

    Foresti, R. & Motterlini, R. Путь гемоксигеназы и его взаимодействие с оксидом азота в контроле клеточного гомеостаза. Free Radic.Res. 31 , 459–475 (1999).

    CAS PubMed Статья PubMed Central Google Scholar

  • 115.

    Franchina, D. G., Dostert, C. & Brenner, D. Реактивные формы кислорода: участие в передаче сигналов и метаболизме Т-клеток. Trends Immunol. 39 , 489–502 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 116.

    Carroll, K.C., Viollet, B. & Suttles, J. Дефицит AMPKα1 усиливает провоспалительную активность миелоидных APC и передачу сигналов CD40. J. Leukoc. Биол. 94 , 1113–1121 (2013).

    PubMed PubMed Central Статья CAS Google Scholar

  • 117.

    Michalek, R.D. et al. Передний край: различные программы гликолитического и липидно-окислительного метаболизма необходимы для эффекторных и регуляторных субпопуляций CD4 + Т-клеток. J. Immunol. 186 , 3299–3303 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 118.

    Krawczyk, C.M. et al. Изменения гликолитического метаболизма, вызванные толл-подобными рецепторами, регулируют активацию дендритных клеток. Кровь 115 , 4742–4749 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 119.

    Полссон-Макдермотт, Э. М. и О’Нил, Л. А. Дж. Нацеливание на иммунометаболизм как противовоспалительную стратегию. Cell Res. 30 , 300–314 (2020).

    PubMed PubMed Central Статья Google Scholar

  • 120.

    Маковски, Л., Чайб, М. и Ратмелл, Дж. К. Иммунометаболизм: от основных механизмов к трансляции. Immunol. Ред. 295 , 5–14 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 121.

    Motterlini, R. & Otterbein, L.E. Терапевтический потенциал окиси углерода. Nat. Rev. Drug Discov. 9 , 728–743 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 122.

    Horio, T. et al. Полиморфизм гена промотора донорской гемоксигеназы-1 позволяет прогнозировать выживаемость после неродственной трансплантации костного мозга пациентам из группы высокого риска. Раки 12 , 424 (2020). Это исследование показывает, что полиморфизм, приводящий к увеличению экспрессии HO-1, приводит к увеличению выживаемости у пациентов, перенесших трансплантацию костного мозга .

    CAS PubMed Central Статья Google Scholar

  • 123.

    Ryter, S. W. & Choi, A. M. K. Нацеливание гемоксигеназы-1 и монооксида углерода для терапевтического регулирования воспаления. Пер. Res. 167 , 7–34 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 124.

    Rueda, B. et al. НО-1 Полиморфизм промотора , связанный с ревматоидным артритом. Arthritis Rheum. 56 , 3953–3958 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 125.

    Yamada, N. et al. Микросателлитный полиморфизм в промоторе гена гемоксигеназы-1 связан с восприимчивостью к эмфиземе. Am. J. Hum. Genet. 66 , 187–195 (2000).

    CAS PubMed PubMed Central Статья Google Scholar

  • 126.

    Takagi, T., Naito, Y., Uchiyama, K. & Yoshikawa, T. Роль гемоксигеназы и окиси углерода в воспалительном заболевании кишечника. Redox Rep. 15 , 193–201 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 127.

    Wang, W.P. et al. Защитная роль гемоксигеназы-1 при колите, вызванном тринитробензолсульфоновой кислотой, у крыс. Am. J. Physiol. Liver Physiol. 281 , G586 – G594 (2001).

    CAS Google Scholar

  • 128.

    Takagi, T. et al. Гемоксигеназа-1 предотвращает воспаление кишечника у мышей. J. Clin. Биохим. Nutr. 63 , 169–174 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 129.

    Hegazi, R.A.F. et al. Окись углерода облегчает хронический колит у мышей через путь, зависимый от гемоксигеназы 1. J. Exp. Med. 202 , 1703–1713 (2005).

    CAS PubMed PubMed Central Статья Google Scholar

  • 130.

    Sheikh, S.Z. et al. Противовоспалительная роль окиси углерода и гемоксигеназы-1 при хроническом Th3-опосредованном колите у мышей. J. Immunol. 186 , 5506–5513 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 131.

    Фогель М. Э. и Цукер С. Д. Билирубин действует как эндогенный регулятор воспаления, нарушая миграцию лейкоцитов, опосредованную молекулами адгезии. Inflamm. Сотовый сигнал. 3 , e1178 (2016).

    PubMed PubMed Central Google Scholar

  • 132.

    Чжэн, Дж.-D. и другие. Неконъюгированный билирубин облегчает экспериментальный язвенный колит, регулируя барьерную функцию кишечника и иммунное воспаление. World J. Gastroenterol. 25 , 1865–1878 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 133.

    Longhi, M. S. et al. Билирубин подавляет иммунитет Th27 при колите за счет активации CD39. JCI Insight 2 , e

  • (2017).

    PubMed Central Статья Google Scholar

  • 134.

    Wu, Y. et al. Гем защищает барьер слизистой оболочки кишечника при колите, вызванном DSS, посредством регулирования поляризации макрофагов как НО-1-зависимым, так и НО-1-независимым образом. FASEB J. 34 , 8028–8043 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 135.

    Horváth, K. et al. Участие активности гемоксигеназы-1 в терапевтических действиях 5-аминосалициловой кислоты при колите у крыс. Eur. J. Pharmacol. 581 , 315–323 (2008).

    PubMed Статья CAS PubMed Central Google Scholar

  • 136.

    Kang, S. et al. Окисленная 5-аминосалициловая кислота активирует путь Nrf2-HO-1 путем ковалентного связывания с Keap1: участие в противовоспалительном действии 5-аминосалициловой кислоты. Free Radic. Биол. Med. 108 , 715–724 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 137.

    Тиррелл Р. М. и Рив В. Е. Потенциальная защита кожи от острого УФ-излучения А - от клеточных моделей до животных. Прог. Биофиз. Мол. Биол. 92 , 86–91 (2006).

    CAS PubMed Статья PubMed Central Google Scholar

  • 138.

    Hanselmann, C., Mauch, C. & Werner, S. Оксигеназа-1 Haem: новый игрок в заживлении кожных ран и псориазе? Biochem. J. 353 , 459–466 (2001).

    CAS PubMed PubMed Central Статья Google Scholar

  • 139.

    El-Rifaie, A.-A. А., Сабри, Д., Досс, Р. В., Камаль, М. А., Абд Эль Хассиб, Д. М. Гем-оксигеназа и статус железа в экзосомах больных псориазом. Arch. Дерматол.Res. 310 , 651–656 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 140.

    Ma, L. J., You, Y., Bai, B. X. & Li, Y.-Z. Терапевтические эффекты гемоксигеназы-1 на псориазоподобных поражениях кожи у морских свинок. Arch. Дерматол. Res. 301 , 459–466 (2009).

    CAS PubMed Статья PubMed Central Google Scholar

  • 141.

    Zhang, B. et al. Индукция гемоксигеназы-1 ослабляет вызванное имиквимодом псориазиформное воспаление за счет отрицательной регуляции передачи сигналов Stat3. Sci. Отчет 6 , 21132 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 142.

    Nisar, M. F., Parsons, K. S. G., Bian, C. X. & Zhong, J. L. Гемоксигеназа-1, индуцированная УФ-излучением: новая фототерапия морфеи. Photochem.Photobiol. 91 , 210–220 (2015).

    CAS PubMed Статья PubMed Central Google Scholar

  • 143.

    Lehmann, J. C.U. et al. Диметилфумарат вызывает иммуносупрессию за счет истощения глутатиона и последующей индукции гемоксигеназы 1. J. Invest. Дерматол. 127 , 835–845 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 144.

    Kasarełło, K. et al. Влияние диметилфумарата на экспрессию гемоксигеназы-1 при экспериментальном аллергическом энцефаломиелите у крыс. Folia Neuropathol. 55 , 325–332 (2017).

    PubMed Статья PubMed Central Google Scholar

  • 145.

    Foresti, R. et al. Низкомолекулярные активаторы антиоксидантной оси Nrf2-HO-1 модулируют метаболизм гема и воспаление в клетках микроглии BV2. Pharmacol.Res. 76 , 132–148 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 146.

    Ghoreschi, K. et al. Фумараты улучшают псориаз и рассеянный склероз, индуцируя дендритные клетки типа II. J. Exp. Med. 208 , 2291–2303 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 147.

    Ogawa, T. et al. Связанный с ядерным фактором эритроид 2 фактор 2 (Nrf2) регулирует кератинизацию эпидермиса при псориатическом воспалении кожи. Am. J. Pathol. 190 , 577–585 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 148.

    Liu, Y. et al. Гемоксигеназа-1 играет важную защитную роль при экспериментальном аутоиммунном энцефаломиелите. Нейроотчет 12 , 1841–1845 (2001).

    CAS PubMed Статья PubMed Central Google Scholar

  • 149.

    Шиппер, Х. М. Экспрессия гемоксигеназы при расстройствах центральной нервной системы человека. Free Radic. Биол. Med. 37 , 1995–2011 (2004).

    CAS PubMed Статья PubMed Central Google Scholar

  • 150.

    Chen, S.-J. и другие. Эритропоэтин усиливает эндогенную оксигеназу-1 гемма и подавляет иммунные ответы для улучшения экспериментального аутоиммунного энцефаломиелита. Clin. Exp. Иммунол. 162 , 210–223 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 151.

    Fagone, P. et al. Предотвращение клинических и гистологических признаков экспериментального аллергического энцефаломиелита (EAE), индуцированного протеолипидным белком (PLP), у мышей с помощью водорастворимой молекулы, высвобождающей монооксид углерода (CORM) -A1. Clin. Exp. Иммунол. 163 , 368–374 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 152.

    Liu, Y. et al. Билирубин как мощный антиоксидант подавляет экспериментальный аутоиммунный энцефаломиелит: значение окислительного стресса в развитии рассеянного склероза. J. Neuroimmunol. 139 , 27–35 (2003).

    CAS PubMed Статья PubMed Central Google Scholar

  • 153.

    Лю Ю., Лю Дж., Тецлафф В., Пати Д. В. и Сайнадер М. С. Биливердинредуктаза, главный физиологический цитопротектор, подавляет экспериментальный аутоиммунный энцефаломиелит. Free Radic. Биол. Med. 40 , 960–967 (2006).

    CAS PubMed Статья Google Scholar

  • 154.

    Саради-Эндрюс, Дж. К. и др. Введение биливердина защищает от вызванного эндотоксином острого повреждения легких у крыс. Am. J. Physiol. Клетка. Мол. Physiol. 289 , L1131 – L1137 (2005).

    CAS Статья Google Scholar

  • 155.

    Ди Пьетро, ​​К., Оз, Х. Х., Мюррей, Т. С. и Брусия, Э. М. Нацеливание на путь гемоксигеназы 1 / монооксида углерода для устранения гипервоспаления легких и восстановления регулируемого иммунного ответа при муковисцидозе. Фронт. Pharmacol. 11 , 1059 (2020).

    PubMed PubMed Central Статья CAS Google Scholar

  • 156.

    Райтер, С. В., Ма, К. К. и Чой, А. М. К. Окись углерода в физиологии и заболеваниях клеток легких. Am. J. Physiol. Physiol. 314 , C211 – C227 (2018).

    Артикул CAS Google Scholar

  • 157.

    Rosas, I.O. et al. Фаза II клинических испытаний низких доз ингаляционного окиси углерода при идиопатическом фиброзе легких. Сундук 153 , 94–104 (2018).

    PubMed Статья Google Scholar

  • 158.

    Casanova, N. et al. Воздействие низких доз окиси углерода при идиопатическом фиброзе легких создает сигнатуру CO, состоящую из генов окислительного фосфорилирования. Sci. Отчет 9 , 1–8 (2019).

    Артикул CAS Google Scholar

  • 159.

    Du, Y. et al. Ассоциация генетических полиморфизмов GSTP1, HO-1 и SOD-3 и восприимчивости к хронической обструктивной болезни легких. Внутр. J. Chron. Препятствовать.Легочный. Дис. 14 , 2081–2088 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 160.

    Fratta Pasini, A. M. et al. Окислительный стресс и экспрессия Nrf2 в мононуклеарных клетках периферической крови, полученных от пациентов с ХОБЛ: наблюдательное продольное исследование. Респир. Res. 21 , 37 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 161.

    Harvey, C.J. et al. Нацеливание на передачу сигналов Nrf2 улучшает клиренс бактерий альвеолярными макрофагами у пациентов с ХОБЛ и в модели на мышах. Sci. Пер. Med. 3 , 78ra32 (2011).

    PubMed PubMed Central Статья CAS Google Scholar

  • 162.

    Bewley, M. A. et al. Опсонический фагоцитоз при хронической обструктивной болезни легких усиливается агонистами Nrf2. Am. J. Respir. Крит.Care Med. 198 , 739–750 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 163.

    Cui, W. et al. Nrf2 ослабляет воспалительную реакцию при ХОБЛ / эмфиземе: перекрестное взаимодействие с путями Wnt3a / β-катенина и AMPK. J. Cell. Мол. Med. 22 , 3514–3525 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 164.

    Shinohara, T. et al. Опосредованный аденовирусом перенос и сверхэкспрессия кДНК гемоксигеназы 1 в легких ослабляет индуцированную эластазой легочную эмфизему у мышей. Гум. Gene Ther. 16 , 318–327 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 165.

    Монтуши П., Харитонов С. А. и Барнс П. Дж. Окись углерода и оксид азота в выдыхаемом воздухе при ХОБЛ. Сундук 120 , 496–501 (2001).

    CAS PubMed Статья PubMed Central Google Scholar

  • 166.

    Yasuda, H. et al. Повышенная концентрация артериального карбоксигемоглобина при хронической обструктивной болезни легких. Am. J. Respir. Крит. Care Med. 171 , 1246–1251 (2005).

    PubMed Статья PubMed Central Google Scholar

  • 167.

    Bathoorn, E.и другие. Противовоспалительные эффекты вдыхаемого окиси углерода у пациентов с ХОБЛ: пилотное исследование. Eur. Респир. J. 30 , 1131–1137 (2007). В этой статье сообщается о ключевом клиническом исследовании, подчеркивающем терапевтический потенциал вдыхаемого CO для лечения воспалительных заболеваний легких .

    CAS PubMed Статья PubMed Central Google Scholar

  • 168.

    Nakao, A. et al. Биливердин защищает функциональную целостность пересаженной сингенной тонкой кишки. Гастроэнтерология 127 , 595–606 (2004).

    CAS PubMed Статья PubMed Central Google Scholar

  • 169.

    Tang, L.-M. M. et al. Экзогенный биливердин улучшает ишемию-реперфузию в небольших трансплантатах печени крыс. Трансплантат. Proc. 39 , 1338–1344 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 170.

    Sugimoto, R. et al. Консервационный раствор с добавлением биливердина предотвращает холодовую ишемию / реперфузионное повреждение легких. Eur. J. Cardiothorac. Surg. 42 , 1035–1041 (2012).

    PubMed PubMed Central Статья Google Scholar

  • 171.

    Yamashita, K. et al. Биливердин, естественный продукт катаболизма гема, вызывает толерантность к сердечным аллотрансплантатам. FASEB J. 18 , 765–767 (2004).

    CAS PubMed Статья Google Scholar

  • 172.

    Одзаки, К. С., Кимура, С. и Мурас, Н. Использование окиси углерода для минимизации ишемии / реперфузионного повреждения при трансплантации. Трансплантат. Ред. 26 , 125–139 (2012).

    Артикул Google Scholar

  • 173.

    Zhou, H. et al. Защита от повреждения трансплантата легкого от доноров с мертвым мозгом с помощью окиси углерода, биливердина или обоих. J. Heart Lung Transpl. 30 , 460–466 (2011).

    Артикул Google Scholar

  • 174.

    Nakao, A. et al. Защита от ишемии / реперфузионного повреждения при трансплантации сердца и почек с помощью монооксида углерода, биливердина и того и другого. Am. J. Transplant. 5 , 282–291 (2005).

    CAS PubMed Статья Google Scholar

  • 175.

    Pileggi, A. et al. Индукция гемоксигеназы-1 в островковых клетках приводит к защите от апоптоза и улучшению функции in vivo после трансплантации. Диабет 50 , 1983–1991 (2001).

    CAS PubMed Статья PubMed Central Google Scholar

  • 176.

    Wang, H. et al. Донорское лечение монооксидом углерода может обеспечить выживаемость и переносимость островкового аллотрансплантата. Диабет 54 , 1400–1406 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 177.

    Yi, T. et al. Активация сигнального пути связанного с ядерным эритроидом 2 фактора 2 антиоксидантно-чувствительного элемента (Nrf2-ARE) облегчает острую болезнь трансплантат против хозяина за счет снижения окислительного стресса и ингибирования инфильтрации воспалительных клеток на мышиной модели с трансплантацией аллогенных стволовых клеток. Med. Sci. Монит. 24 , 5973–5979 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 178.

    Bedard, E. L. R. et al. Обработка перитрансплантата протопорфирином кобальта ослабляет хроническое отторжение почечного аллотрансплантата. транспл. Int. 18 , 341–349 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 179.

    Tsui, T. Y. et al.Предотвращение хронического разрушения сердечного аллотрансплантата путем переноса гена гемоксигеназы-1, опосредованного рекомбинантным аденоассоциированным вирусом. Тираж 107 , 2623–2629 (2003).

    CAS PubMed Статья PubMed Central Google Scholar

  • 180.

    Chauveau, C. et al. Перенос генов гемоксигеназы-1 и доставка моноксида углерода ингибируют хроническое отторжение. Am. J. Transpl. 2 , 581–592 (2002).

    CAS Статья Google Scholar

  • 181.

    Кори, Х., Пассарелли, С., Сзето, Дж., Тамез, М. и Маттеи, Дж. Роль полифенолов в здоровье человека и пищевых системах: мини-обзор. Фронт. Nutr. 5 , 87 (2018).

    PubMed PubMed Central Статья CAS Google Scholar

  • 182.

    Моттерлини Р., Форести Р., Басси Р.& Green, C.J. Куркумин, антиоксидант и противовоспалительный агент, индуцирует гемоксигеназу-1 и защищает эндотелиальные клетки от окислительного стресса. Free Radic. Биол. Med. 28 , 1303–1312 (2000).

    CAS PubMed Статья PubMed Central Google Scholar

  • 183.

    Chen, C.Y., Jang, J.H., Li, M.H. и Surh, Y.J. Ресвератрол усиливает экспрессию гемоксигеназы-1 посредством активации фактора 2, связанного с NF-E2, в клетках PC12. Biochem. Биофиз. Res. Commun. 331 , 993–1000 (2005).

    CAS PubMed Статья PubMed Central Google Scholar

  • 184.

    Kim, Y. et al. Кверцетин снижает атрофию мышц, вызванную фактором некроза опухоли альфа, за счет активации гемоксигеназы-1. J. Med. Еда 21 , 551–559 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 185.

    Funes, S.C. et al. Индукторы гемоксигеназы 1 природного происхождения и их терапевтическое применение при иммуноопосредованных заболеваниях. Фронт. Иммунол. 11 , 1467 (2020). Этот обзор предоставляет всесторонний обзор терапевтического потенциала природных индукторов HO-1 .

    CAS PubMed PubMed Central Статья Google Scholar

  • 186.

    Уильямсон, Г. и Клиффорд, М.N. Роль тонкой кишки, толстой кишки и микробиоты в определении метаболической судьбы полифенолов. Biochem. Pharmacol. 139 , 24–39 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 187.

    Del Rio, D. et al. Диетические (поли) фенолы в здоровье человека: структуры, биодоступность и доказательства защитного действия против хронических заболеваний. Антиоксид. Редокс-сигнал. 18 , 1818–1892 (2013).

    PubMed PubMed Central Статья CAS Google Scholar

  • 188.

    Antiga, E. et al. Пероральный куркумин (Neriva) эффективен в качестве адъювантного лечения и способен снижать уровни IL-22 в сыворотке крови у пациентов с вульгарным псориазом. Biomed. Res. Int. 2015 , 283634 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 189.

    Курд, С. К. и др. Пероральный куркумин в лечении умеренного и тяжелого вульгарного псориаза: проспективное клиническое исследование. J. Am. Акад. Дерматол. 58 , 625–631 (2008).

    PubMed PubMed Central Статья Google Scholar

  • 190.

    Liu, X. et al. Диметилфумарат ослабляет индуцированный декстрансульфатом натрия экспериментальный колит у мышей, активируя Nrf2 и подавляя активацию воспаления NLRP3. Biochem. Pharmacol. 112 , 37–49 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 191.

    Nakayama, T. et al. Фотооблучение после лечения аминолевулиновой кислотой подавляет пролиферацию раковых клеток через путь HO-1 / p21. Фотодиагностика Photodyn. Ther. 28 , 10–17 (2019).

    CAS PubMed Статья PubMed Central Google Scholar

  • 192.

    Hou, J. et al. 5-Аминолевулиновая кислота с двухвалентным железом вызывает постоянное принятие сердечного аллотрансплантата у мышей посредством индукции регуляторных клеток. J. Heart Lung Transpl. 34 , 254–263 (2015).

    Артикул Google Scholar

  • 193.

    Наримия Т. и др. Активация Nrf2 в остеобластах подавляет остеокластогенез за счет ингибирования экспрессии IL-6. Костный Реп. 11 , 100228 (2019).

    PubMed PubMed Central Статья Google Scholar

  • 194.

    Yan, S.C. et al. Дигидроартемизинин регулирует баланс Th / Treg, индуцируя апоптоз активированных CD4 + Т-клеток посредством индукции гемоксигеназы-1 на мышиных моделях воспалительного заболевания кишечника. Молекулы 24 , 2475 (2019).

    CAS PubMed Central Статья Google Scholar

  • 195.

    Lin, C.-C., Yang, C.-C., Hsiao, L.-D., Chen, S.-Y. И Ян, К.-М. Индукция гемоксигеназы-1 высвобождающей монооксид углерода молекулой-3 подавляет нейровоспаление, опосредованное интерлейкином-1β. Фронт. Мол. Neurosci. 10 , 387 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 196.

    Song, L. et al. Молекула, высвобождающая моноксид углерода, подавляет воспалительные и остеокластогенные цитокины в клетках пародонтальной связки человека, стимулированных никотином и липополисахаридами, посредством пути гемоксигеназы-1. Внутр. J. Mol. Med. 40 , 1591–1601 (2017).

    CAS PubMed Статья PubMed Central Google Scholar

  • 197.

    Mangano, K. et al. Вовлечение оси Nrf2 / HO-1 / CO и терапевтическое вмешательство с помощью CO-высвобождающей молекулы CORM-A1 в мышиной модели аутоиммунного гепатита. J. Cell. Physiol. 233 , 4156–4165 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 198.

    Takagi, T. et al. Окись углерода облегчает Т-клеточно-зависимый колит у мышей за счет ингибирования дифференцировки Th27. Free Radic. Res. 52 , 1328–1335 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 199.

    Ji, X. et al. К терапевтическим средствам на основе монооксида углерода: важнейшие вопросы доставки и разработки лекарств. J. Pharm. Sci. 105 , 406–416 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 200.

    El Ali, Z. et al. Терапевтические эффекты гибридов высвобождающего СО / активатора Nrf2 (HYCO) при лечении кожных ран, псориаза и рассеянного склероза. Редокс Биол. 34 , 101521 (2020). Это важное исследование, изучающее терапевтический потенциал гибридных молекул, высвобождающих CO, для ряда воспалительных заболеваний .

    CAS PubMed PubMed Central Статья Google Scholar

  • 201.

    Motterlini, R. et al. HYCO-3, двойной активатор CO-высвобождение / Nrf2, снижает воспаление тканей у мышей, которым вводили липополисахарид. Редокс Биол. 20 , 334–348 (2019).

    CAS PubMed Статья PubMed Central Google Scholar

  • 202.

    Бамбускова, М.и другие. Электрофильные свойства итаконата и производных регулируют воспалительную ось IκBζ-ATF3. Природа 556 , 501–504 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 203.

    Tang, C. et al. 4-Октилитаконат активирует передачу сигналов Nrf2 для подавления продукции провоспалительных цитокинов в мононуклеарных клетках периферической крови пациентов с системной красной волчанкой. Cell.Physiol. Биохим. 51 , 979–990 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 204.

    Davies, T. G. et al. Одноосновные ингибиторы Kelch-подобного ECH-ассоциированного белка 1: ядерный фактор, связанный с эритроидом 2, фактор 2 (KEAP1: NRF2), взаимодействие белок-белок с высокой клеточной активностью, идентифицированной с помощью обнаружения на основе фрагментов. J. Med. Chem. 59 , 3991–4006 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 205.

    Campbell, N. K. et al. Ароматические кетокислоты, секретируемые Trypanosoma brucei, активируют путь Nrf2 / HO-1 и подавляют провоспалительные реакции в первичной мышиной глии и макрофагах. Фронт. Иммунол. 10 , 2137 (2019).

    CAS PubMed PubMed Central Статья Google Scholar

  • 206.

    McGettrick, A. F. et al. Trypanosoma brucei метаболит индолепируват снижает HIF-1α и гликолиз в макрофагах как механизм уклонения от врожденного иммунитета. Proc. Natl Acad. Sci. США 113 , E7778 – E7787 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 207.

    Шульц, С., Вонг, Р. Дж., Времан, Х. Дж. И Стивенсон, Д. К. Металлопорфирины - обновленная информация. Фронт. Pharmacol. 3 , 68 (2012).

    PubMed PubMed Central Статья Google Scholar

  • 208.

    Mucha, O. et al. Фармакологическое и генетическое ингибирование гемоксигеназы-1 - сравнение металлопорфиринов, shРНК и системы CRISPR / Cas9. Acta Biochim. Pol. 65 , 277–286 (2018). В этой статье сравнивается ряд методов ингибирования HO-1, имеющих отношение к экспериментальной модуляции HO-1 и разработке терапевтических ингибиторов HO-1 .

    CAS PubMed Статья PubMed Central Google Scholar

  • 209.

    Lian, K.-C. и другие. Двойные механизмы ингибирования NF-kappaB в эндотелиальных клетках, обработанных карнозолом. Toxicol. Прил. Pharmacol. 245 , 21–35 (2010).

    CAS PubMed Статья PubMed Central Google Scholar

  • 210.

    Серра, Д., Алмейда, Л.М.И Динис, Т.С.П. Противовоспалительная защита, обеспечиваемая цианидин-3-глюкозидом и ресвератролом в клетках кишечника человека через Nrf2 и PPAR-γ: сравнение с 5-аминосалициловой кислотой. Chem. Биол. Взаимодействовать. 260 , 102–109 (2016).

    CAS PubMed Статья PubMed Central Google Scholar

  • 211.

    Wang, G. et al. Ресвератрол улучшает ревматоидный артрит за счет активации сигнального пути SIRT1-Nrf2. Биофакторы 46 , 441–453 (2020).

    CAS PubMed Статья PubMed Central Google Scholar

  • 212.

    Ju, S. et al. Диетический кверцетин облегчает экспериментальный колит у мышей за счет ремоделирования функции макрофагов толстой кишки через гемоксигеназу-1-зависимый путь. Cell Cycle 17 , 53–63 (2018).

    CAS PubMed PubMed Central Статья Google Scholar

  • 213.

    Guazelli, C. F. S. et al. Кверцетин ослабляет артрит, вызванный зимозаном, у мышей. Biomed. Фармакотер. 102 , 175–184 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 214.

    Yang, Y. et al. Кверцетин ослабляет коллаген-индуцированный артрит за счет восстановления баланса Th27 / Treg и активации противовоспалительного действия, опосредованного гемоксигеназой 1. Внутр. Иммунофармакол. 54 , 153–162 (2018).

    CAS PubMed Статья PubMed Central Google Scholar

  • 215.

    Wagner, A. E. et al. Острый колит, индуцированный DSS, у мышей C57BL / 6 смягчается предварительной обработкой сульфорафаном. J. Nutr. Биохим. 24 , 2085–2091 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 216.

    Li, B. et al. Сульфорафан облегчает развитие экспериментального аутоиммунного энцефаломиелита за счет противодействия окислительному стрессу и воспалению, связанному с Th27, у мышей. Exp. Neurol. 250 , 239–249 (2013).

    CAS PubMed Статья PubMed Central Google Scholar

  • 217.

    Geisel, J. et al. Сульфорафан защищает от опосредованного Т-клетками аутоиммунного заболевания путем ингибирования IL-23 и IL-12 в дендритных клетках. J. Immunol. 192 , 3530–3539 (2014).

    CAS PubMed Статья PubMed Central Google Scholar

  • 218.

    Ганц Т. Макрофаги и системный гомеостаз железа. J. Врожденный иммунитет. 4 , 446–453 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 219.

    Dixon, S.J. et al.Ферроптоз: железозависимая форма неапоптотической гибели клеток. Ячейка 149 , 1060–1072 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 220.

    Корольнек Т. и Хамза И. Макрофаги и торговля железом при рождении и смерти эритроцитов. Кровь 125 , 2893–2897 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 221.

    Theurl, I. et al. Для удаления эритроцитов и повторного использования железа требуются временные макрофаги в печени. Nat. Med. 22 , 945–951 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 222.

    Ковтунович, Г., Экхаус, М.А., Гош, М.С., Оливьер-Вильсон, Х. и Руо, Т.А. Дисфункция системы рециркуляции гема у мышей с дефицитом гемоксигеназы 1: влияние на жизнеспособность макрофагов и тканевое железо распределение. Кровь 116 , 6054–6062 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 223.

    Poss, K. D. & Tonegawa, S. Гемоксигеназа 1 необходима для повторного использования железа у млекопитающих. Proc. Natl Acad. Sci. США 94 , 10919–10924 (1997).

    CAS PubMed Статья PubMed Central Google Scholar

  • 224.

    Сухбаатар, Н. и Вейхарт, Т. Регуляция железа: макрофаги под контролем. Фармацевтические препараты 11 , 137 (2018).

    CAS PubMed Central Статья Google Scholar

  • 225.

    Экснер, М., Минар, Э., Вагнер, О. и Шиллингер, М. Роль полиморфизмов промотора гемоксигеназы-1 в заболеваниях человека. Free Radic. Биол. Med. 37 , 1097–1104 (2004).

    CAS PubMed Статья PubMed Central Google Scholar

  • 226.

    Соарес, М. П. и Бах, Ф. Х. Гемоксигеназа-1: от биологии к терапевтическому потенциалу. Trends Mol. Med. 15 , 50–58 (2009).

    CAS PubMed Статья PubMed Central Google Scholar

  • 227.

    Lin, Q. et al. Белок гемоксигеназы-1 локализуется в ядре и активирует факторы транскрипции, важные при окислительном стрессе. J. Biol. Chem. 282 , 20621–20633 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 228.

    Biswas, C. et al. Ядерная гемоксигеназа-1 (HO-1) модулирует внутриклеточное распределение и активацию Nrf2, влияя на метаболическую и антиоксидантную защиту. J. Biol. Chem. 289 , 26882–26894 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 229.

    Stocker, R., Yamamoto, Y., McDonagh, A. F., Glazer, A. N. & Ames, B. N. Билирубин является антиоксидантом, имеющим возможное физиологическое значение. Наука 235 , 1043–1046 (1987).

    CAS PubMed Статья PubMed Central Google Scholar

  • 230.

    Barañano, D. E. et al. Биливердинредуктаза: главный физиологический цитопротектор. Proc. Natl Acad. Sci. США 99 , 16093–16098 (2002).

    PubMed Статья CAS PubMed Central Google Scholar

  • 231.

    Sedlak, T. W. et al. Билирубин и глутатион выполняют взаимодополняющие антиоксидантные и цитопротекторные функции. Proc. Natl Acad. Sci. США 106 , 5171–5176 (2009).

    CAS PubMed Статья PubMed Central Google Scholar

  • 232.

    Янсен, Т. и Дайбер, А.Прямые антиоксидантные свойства билирубина и биливердина. Есть ли роль биливердинредуктазы? Фронт. Pharmacol. 3 , 30 (2012).

    PubMed PubMed Central Статья Google Scholar

  • 233.

    Canesin, G., Hejazi, S. M., Swanson, K. D. & Wegiel, B. Полученные из гема метаболические сигналы диктуют иммунные ответы. Фронт. Иммунол. 11 , 66 (2020).

    CAS PubMed PubMed Central Статья Google Scholar

  • 234.

    Kim, K. M. et al. Окись углерода индуцирует гемоксигеназу-1 посредством активации протеинкиназы R-подобной киназы эндоплазматического ретикулума и ингибирует апоптоз эндотелиальных клеток, вызванный стрессом эндоплазматического ретикулума. Circ. Res. 101 , 919–927 (2007).

    CAS PubMed Статья PubMed Central Google Scholar

  • 235.

    Yang, Y.-C. К., Хуанг, Ю.-Т. T., Hsieh, C.-W. W., Yang, P.-M. М. и Вунг Б.-S. S. Окись углерода индуцирует гемоксигеназу-1, чтобы модулировать активацию STAT3 в эндотелиальных клетках посредством S-глутатионилирования. PLoS ONE 9 , e100677 (2014).

    PubMed PubMed Central Статья CAS Google Scholar

  • 236.

    Chiang, N. et al. Вдыхаемый монооксид углерода ускоряет разрешение воспаления за счет уникальных цепей прореагирования медиатор-гемоксигеназа-1. J. Immunol. 190 , 6378–6388 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • Справочник по устройству Stratix, тома 1 и 2

    % PDF-1.3 % 1 0 объект > эндобдж 2 0 obj >>> эндобдж 3 0 obj > поток Acrobat Distiller 7.0 (Windows) июль 2005 г. "Руководство по устройству Stratix, том 1, том 2, архитектура, конфигурация и тестирование, характеристики, справочная информация и информация для заказа, память, ввод-вывод, DSP, stratix, устройство stratix, trimatrixFrameMaker 7.02006-06-01T14: 04: 31-07: 002006-01-24T10: 20: 16Z2006-06-01T14: 04: 31-07: 00application / pdf Справочник по устройству Stratix

  • , тома 1 и 2, архитектура, конфигурация и тестирование , Характеристики, справочная информация и информация для заказа
  • Справочник по устройству Stratix
  • , тома 1 и 2
  • Altera Corporation
  • Справочник по устройству Stratix, том 1, том 2, Архитектура, конфигурация и тестирование, характеристики, справочная информация и информация для заказа, память, ввод / вывод, DSP, stratix, устройство stratix, trimatrix
  • Июль 2005 г. uuid: b9bff013-393f-45a3-a8bc-4a4a20b6e155uuid: b7f7b2e0-750c-4a33-b206-61710e72bfc6 конечный поток эндобдж 4 0 объект > эндобдж 5 0 obj > эндобдж 6 0 obj > эндобдж 7 0 объект > эндобдж 8 0 объект > эндобдж 9 0 объект > эндобдж 10 0 obj > эндобдж 11 0 объект > эндобдж 12 0 объект > эндобдж 13 0 объект > эндобдж 14 0 объект > эндобдж 15 0 объект > эндобдж 16 0 объект > эндобдж 17 0 объект > эндобдж 18 0 объект > эндобдж 19 0 объект > эндобдж 20 0 объект > эндобдж 21 0 объект > эндобдж 22 0 объект > эндобдж 23 0 объект > эндобдж 24 0 объект > эндобдж 25 0 объект > эндобдж 26 0 объект > эндобдж 27 0 объект > эндобдж 28 0 объект > эндобдж 29 0 объект > поток HW [8 ~ c, QO | 6f /> NhÖJS {.Ղ f% 4q || .w.mz? Y \ = 凉 a6% 1EL + 4z8iO $ / DLJr> cUzt2T43YU *: L` & ʚ "lɴJyDJd 'ꁫ9 助 s45U xD * ʉ

    Пограничное расстройство личности и детские травмы: изучение пораженные биологические системы и механизмы | BMC Psychiatry

    Нейробиологические механизмы, участвующие в БЛД

    БЛД и ось гипоталамо-гипофиз-надпочечники

    Гипоталамо-гипофизарно-надпочечниковая ось (HPA) является одной из нейроэндокринных систем, которые опосредуют реакцию организм подвергается стрессу. Хотя механизм стрессовой реакции предназначен для поддержания стабильности или гомеостаза, его длительная активация в результате воздействия хронического стресса может иметь пагубные последствия для организма, повышая риск развития различных видов заболеваний, в том числе психические расстройства, связанные со стрессом.

    В стрессовых условиях кортикотропин-рилизинг-фактор (CRF) и аргинин-вазопрессин (AVP) высвобождаются из паравентрикулярного ядра (PVN), расположенного в гипоталамусе. Эти пептиды проходят через портальную систему гипофиза и действуют синергетически, стимулируя высвобождение адренокортикотропного гормона (АКТГ) из кортикотрофных клеток. Затем АКТГ транспортируется по системному кровообращению и связывается с рецепторами в коре надпочечников надпочечника, что приводит к биосинтезу и высвобождению кортизола [19].Кортизол может влиять на несколько органов и биологические процессы, такие как метаболизм, рост, воспаление, сердечно-сосудистую функцию, когнитивные функции и поведение [20, 21], связываясь со специфическими рецепторами в организме и в нескольких областях мозга, таких как гипоталамус, передняя доля гипофиза. и медиальная префронтальная кора. Центральные и периферические эффекты кортизола опосредуются двумя подтипами внутриклеточных глюкокортикоидных рецепторов: высокоаффинным рецептором типа I или рецептором минеральных кортикоидов (MR) и рецептором низкоаффинного типа или рецептором глюкокортикоидов (GR).Было высказано предположение, что MR имеют высокое сродство как к кортизолу, так и к альдостерону; они связывают кортизол, когда он обнаруживается в низких концентрациях. GR имеют относительно низкое сродство к кортизолу, но высокое сродство к дексаметазону (DEX) [22]; кроме того, они связывают кортизол в высокой концентрации, отражая то, что происходит в стрессовых условиях.

    Ось HPA регулируется саморегулирующим механизмом, опосредованным самим кортизолом, который имеет решающее значение для поддержания гомеостатических функций оси HPA.Действительно, когда уровни кортизола повышаются, как в ответ на стресс, MR насыщаются, и, следовательно, кортизол связывает GR, способствуя каскаду событий, которые представляют основные сигналы трансдукции глюкокортикоидов в стрессовых условиях.

    До сих пор активность оси HPA широко исследовалась в контексте переживаний детских травм, и результаты подтверждают изменения оси HPA у субъектов, подвергшихся стрессу в раннем возрасте. Действительно, в нескольких исследованиях сообщалось об изменениях циркадных ритмов и уровней кортизола, что указывает на дерегуляцию чувствительности оси HPA из-за травм в детстве при стрессовых условиях [23,24,25].

    Несмотря на большой объем данных о функциональности оси HPA как следствие воздействия стресса в раннем возрасте, лишь в нескольких исследованиях изучались возможные изменения этой оси у пациентов с ПРЛ. Например, у пациентов с БЛД был обнаружен более высокий уровень кортизола в моче по сравнению с контрольной группой [26, 27].

    Саутвик и его коллеги [26] обнаружили более высокие уровни кортизола в суточной моче у пациентов с посттравматическим стрессовым расстройством по сравнению с пациентами с посттравматическим стрессовым расстройством и сопутствующей патологией ПРЛ, предполагая, что эти изменения могут отражать различия в тяжести симптомов посттравматического стрессового расстройства, а не факторы, связанные с ПРЛ как таковые.

    В другом исследовании [27] изучали уровни свободного кортизола в моче в течение ночи, показав более высокие уровни кортизола у пациентов с БЛД, чем в контрольной группе. Также наблюдалась отрицательная связь между кортизолом и симптомами посттравматического стресса. Более того, когда пациенты с ПРЛ были разделены в зависимости от наличия большого или низкого количества симптомов посттравматического стрессового расстройства, очень высокие уровни кортизола были обнаружены только у пациентов с ПРЛ с низким количеством симптомов посттравматического стрессового расстройства. Ринне с соавторами [28] обнаружили преувеличенную реакцию АКТГ и кортизола во время теста DEX / CRH в крови женщин-испытуемых с ПРЛ, переживших жестокое обращение в детстве.Карвалью Фернандо и его коллеги [29] исследовали влияние введения кортизола на подавление реакции на эмоциональные стимулы у пациентов с ПРЛ по сравнению с контрольной группой. Они обнаружили, что резкое повышение уровня кортизола уменьшало время реакции на целевые стимулы как у пациентов с ПРЛ, так и у контрольной группы, но они не различались по выполнению заданий.

    Также исследования генетических ассоциаций подтверждают изменения в функциональности оси HPA в связи с воздействием детских травм. Мартин-Бланко с соавторами [30] исследовали вклад генетических вариантов в генах по оси HPA, также в контексте воздействия детских травм, в выборке пациентов с ПРЛ и контрольной группы.Авторы выполнили исследование случай-контроль, сосредоточив внимание на 47 SNP в 10 генах оси HPA. Данные показали связь между полиморфными вариантами в генах связывающего белка 5 FK506 (FKBP5) и рецептора высвобождающего гормона кортикотропина (CRHR) с диагнозом БЛД. В частности, два полиморфизма FKBP5, rs4713902 и rs79, показали значительную связь с БЛД. Более сильные ассоциации были обнаружены у пациентов, перенесших травму в детстве, где аллели риска двух других полиморфизмов FKBP5, rs3798347-T и rs103-A, чаще были представлены у пациентов с физическим насилием и эмоциональным пренебрежением в детстве, чем у пациентов, которые никогда не сталкивались с этим. испытали эти травмы и контроль.

    Все эти результаты предполагают связь между нарушением регуляции функции оси HPA и детской травмой и подчеркивают участие этой биологической системы в развитии ПРЛ.

    BPD и нейротрансмиссия

    В дополнение к наличию дисфункции оси HPA, несколько исследований также предположили, что детская травма может влиять на глутаматергическую, серотонинергическую, дофаминергическую и норадренергическую передачу, предполагая, что BPD является результатом изменений в нескольких взаимодействующих системах нейротрансмиттеров [ 31, 32].

    Глутаматергическая нейротрансмиссия и нейротрансмиссия N-метил-D-аспартата (NMDA) играют решающую роль в развитии нервной системы, синаптической пластичности, обучении и памяти [33, 34], и изменения во всех этих процессах также влияют на уязвимость и патофизиологию БЛД. [35]. Например, нейровизуализационные исследования у пациентов с ПРЛ по сравнению с контрольной последовательно продемонстрировали наличие пониженной плотности и объема синапсов в нескольких областях мозга, участвующих в пространственной или автобиографической памяти и в модуляции бдительности и негативных эмоциональных состояний, таких как гиппокамп и миндалевидное тело. которые также обогащены рецепторами NMDA [36] (см. также параграф «Исследования ПРЛ и нейровизуализации»).Более того, было обнаружено, что ранний хронический стресс и плохое обращение, пережитые в течение жизни пациентами с ПРЛ, способны влиять на ветвление дендритов, тем самым способствуя развитию морфологических изменений, связанных с симптомами ПРЛ [37, 38].

    Ген транспортера серотонина (5-HTTLPR) и связанная с ним передача сигналов при нейротрансмиссии представляют собой другую систему, участвующую в патогенезе БЛД [39,40,41,42]. В частности, в нескольких исследованиях широко сообщалось, что функциональный однонуклеотидный полиморфизм (SNP) в этом гене (5-HTTLPR S / L SNP) является модулятором стрессовых событий в раннем возрасте [43,44,45]; Интересно, что это также было связано с симптомами ПРЛ [42, 46].Например, Вагнер с соавторами [42] исследовали влияние 5-HTTLPR S / L SNP и стрессовых событий в раннем периоде жизни на импульсивность, оцениваемую по шкале импульсивности Барратта (BIS), у пациентов с ПРЛ. Авторы сообщили о связи между наличием стрессовых событий и более низкими показателями импульсивности BIS, предполагая, что субъекты, пережившие травму, в частности сексуальное насилие, могут проявлять сниженную импульсивность в результате активации механизмов совладания с поведением и социальным взаимодействием. .Дальнейший анализ, проведенный теми же авторами, показал, что носители S-аллеля показали более высокие баллы импульсивности при воздействии стрессовых событий в раннем возрасте по сравнению с LL-омозиготами, что позволяет предположить, что пациенты с S-аллелем 5-HTTLPR более уязвимы к стрессу в раннем возрасте. Эти данные подчеркивают вклад серотонинергической системы в импульсивность при ПРЛ [42].

    Другой ген, предположительно являющийся генетическим фактором риска БЛД, представлен катехол-О-метилтрансферазой (СОМТ), ферментом, катализирующим деградацию катехоламинов, включая нейротрансмиттеры дофамин, адреналин и норадреналин; однако литературные данные о роли этого гена противоречивы.В первом исследовании, проведенном Вагнером и соавторами [47], было обнаружено, что SNP COMT Val 158 Met ассоциирован со стрессовыми событиями в раннем возрасте и импульсивной агрессией, по оценке по сумме баллов Buss-Durkee-Hostility Inventory (BDHI), в пациентки с БЛД. В частности, авторы определили, что у носителей COMT Val 158 Val, но не у носителей Val / Met и Met / Met, сексуальное насилие в детстве и совокупное количество стрессовых событий были связаны с более низкими показателями импульсной агрессии BDHI.Однако в другом исследовании, проведенном теми же авторами, влияние SNP COMT Val 158 Met на связь между стрессовыми жизненными событиями и импульсивностью не подтвердилось [48], вероятно, из-за небольшого размера выборки. Те же авторы [49] также исследовали в группе пациентов с БЛД и контрольной группе роль (i) SNP COMT Val 158 Met, (ii) варианта 5-HTTLPR S / L и (iii) их взаимодействия. как факторы генетической уязвимости для ПРЛ. Данные показали, что генотип COMT Met 158 Met был чрезмерно представлен у пациентов с БЛД, чем в контрольной группе, тогда как не сообщалось о различиях в генотипе 5-HTTLPR между БЛД и контрольной группой.Кроме того, генотип COMT Met 158 Met был значительно перепредставлен у пациентов с БЛД, несущих хотя бы один S-аллель 5-HTTLPR и, что интересно, взаимодействие между COMT Met 158 и S-аллелем 5-HTTLPR. также наблюдалось. Эти результаты предполагают интерактивный эффект вариантов генов COMT и 5-HTTLPR на уязвимость к развитию БЛД и, по мнению авторов, еще раз подчеркивают ключевую роль серотонинергической и дофаминергической систем в патогенезе БЛД.

    Martin-Blanco и его сотрудники [50] исследовали возможное участие норадренергической системы в патогенезе BDP, оценивая генетические варианты в 4 норадренергических генах. В дополнение к COMT, авторы выбрали дофамин-бета-гидроксилазу (DBH), которая преобразует дофамин в норадреналин, Solute Carrier Family 6 Member 2 (SLC6A2), переносчик, ответственный за обратный захват внеклеточных нейротрансмиттеров, и адренорецептор бета 2 (ADRB2). , который опосредует катехоламин-индуцированную активацию аденилатциклазы за счет действия G-белков.Результаты авторов показали, что только генетические варианты в пределах 3 генов (COMT, DBH и SLC6A2) были связаны с повышенным риском развития БЛД.

    Эти исследования, вместе взятые, показывают, что изменения в нескольких системах нейромедиаторов могут быть вовлечены в патогенез БЛД; однако из-за небольшого количества доступных исследований необходимы дальнейшие исследования.

    БЛД и эндогенная опиоидная система

    Согласно теории Банделоу и Шмаль, снижение чувствительности опиоидных рецепторов или доступность эндогенных опиоидов может составлять часть патофизиологии, лежащей в основе БЛД [51].

    Эндогенные опиоиды в основном включают три класса (эндорфины, энкефалины и динорфины), которые активируют три типа рецепторов, связанных с G-белком (μ, δ и κ опиоидные рецепторы [52]). Одним из наиболее важных эндогенных опиоидов является β-эндорфин, который частично синтезируется в дугообразном ядре гипоталамуса и попадает в кровь, спинной мозг и в различные области мозга, включая области, связанные с вознаграждением [53]. β-эндорфин активируется различными стрессовыми факторами [54] и вызывает эйфорию и анальгетический эффект (например, во время родов и во время положительных переживаний [55]).

    μ-опиоидные рецепторы, по-видимому, более важны для социальной и аффективной регуляции, связанной с ПРЛ, предполагая, что эта система может способствовать межличностной уязвимости и внутриличностной боли при ПРЛ. Эти рецепторы широко распространены по всей центральной нервной системе (ЦНС) человека, с определенной плотностью в базальных ганглиях, корковых структурах, ядрах таламуса, спинном мозге и определенных ядрах ствола мозга [56].

    Эндогенная опиоидная система модулирует реакции на острые и хронические стрессовые и вредные раздражители, вызывающие физическую, эмоциональную или социальную боль.В моделях на животных эндогенная опиоидная система участвует в аффилиативных реакциях, регуляции эмоций и стресса, включая вызванное стрессом обезболивание и импульсивное поведение [57]. Используя парадигму разделения матери и ребенка у макак-резусов, Калин с сотрудниками [57] впервые изучили роль опиоидной системы в модулировании поведенческих и нейроэндокринных последствий кратковременного стрессора. Авторы провели несколько экспериментов, в которых животные получали морфин, опиоидный агонист, налоксон, антагонист опиоидов или и то, и другое, чтобы проверить усиление вокализации и активацию оси HPA у новорожденных приматов, разлученных со своими матерями или нет.Результаты показали, что морфин значительно снижал вокализацию и локомоцию, вызванные разделением, не влияя на уровни активности, тогда как налоксон увеличивал вокализации, вызванные разделением, и исследования окружающей среды. При совместном введении двух препаратов действие морфина отменялось только при дозе налоксона 0,1 мг / кг. Авторы также оценили влияние разделения на нейроэндокринную функцию и проверили, может ли активация опиоидной системы ослабить эти эффекты, путем измерения концентраций АКТГ и кортизола в плазме у детенышей макак-резусов, разлученных или не разлученных со своими матерями, получавших морфин, налоксон или другие препараты. - лечится двумя препаратами.Уровни АКТГ и кортизола в плазме были выше у детенышей макак-резусов, разлученных со своими матерями, по сравнению с неразделенными, что подтверждает участие оси HPA во время стрессового воздействия. Однако только уровни АКТГ в плазме модулировались морфином и налоксоном и их взаимодействием в группе младенцев, разделенных их матерями. Эти данные свидетельствуют о том, что эндогенная опиоидная система участвует в обеспечении вокализации, вызванной разделением, и влияет на активацию оси HPA после стрессового состояния.

    У людей активация региональной эндогенной опиоидной системы была связана с подавлением как сенсорных, так и аффективных качеств стрессоров, а также с импульсивностью признаков [58,59,60], тогда как ее региональная деактивация была связана с гипералгезическими реакциями и усилением негативного аффекта во время стресс [61]. Гипотеза состоит в том, что активация μ-опиоидных рецепторов может иметь подавляющий эффект во время эмоциональных или физических проблем, угрожающих гомеостазу организма.

    Исследования описали региональные изменения функции эндогенной опиоидной системы и μ-опиоидных рецепторов в областях мозга, участвующих в обработке эмоций и стресса, принятии решений, а также регуляции боли и нейроэндокринной системы.Однако на сегодняшний день имеется лишь ограниченное количество данных об изменениях уровней эндогенных опиоидов у пациентов с ПРЛ. В интересном исследовании Prossin и соавторы [61] исследовали роль эндогенной опиоидной системы и μ-опиоидных рецепторов в регуляции эмоций у женщин с ПРЛ, не получавших лекарств, по сравнению с женщинами контрольной группы, используя позитронно-эмиссионную томографию (ПЭТ) (см. Параграф «ПРЛ»). и нейровизуализационные исследования »для деталей).

    Сравнивая пациентов с БЛД и их контрольную группу, авторы обнаружили значительные различия в исходных региональных концентрациях μ-опиоидных рецепторов in vivo, а также в реакции этой нейромедиаторной системы на отрицательный эмоциональный вызов, который может быть связан с некоторыми клиническими характеристиками БЛД.

    Исследования ПРЛ и нейровизуализации

    Объемные изменения в областях мозга, участвующих в реакции на стресс

    На сегодняшний день у пациентов с ПРЛ было проведено несколько функциональных и структурных исследований нейровизуализации in vivo, в ходе которых были обнаружены изменения, локализованные в основном в лимбической цепи и в лобной коре. Эти области связаны с отличительными клиническими признаками расстройства (т.е. импульсивностью, агрессией и эмоциональной реактивностью). Наиболее воспроизводимый результат, подтвержденный в недавних метаанализах [37, 62, 63], представлен уменьшением объемов гиппокампа и миндалины у пациентов с БЛД по сравнению с контрольной группой [36, 64, 65, 66, 67, 68,69].Надежность этого открытия, по-видимому, предполагает, что уменьшение объема в этих двух областях мозга может быть специфическим для ПРЛ и, таким образом, полезно в качестве возможных эндофенотипов болезни. В 2000 году Дриссен с соавторами [36] выполнили первое объемное измерение гиппокампа, миндалины, височных долей и переднего мозга с помощью магнитно-резонансной томографии у 21 пациентки с ПРЛ и женщин контрольной группы, сообщив у пациентов с ПРЛ об уменьшении объема гиппокампа на 16%. и 8% в миндалине.Более того, объемы гиппокампа отрицательно коррелировали со степенью и продолжительностью ранней травмы, о которой сообщали сами пациенты, но только во всей выборке пациентов с БЛД и контрольной группы.

    Роль посттравматического стрессового расстройства и травмы как сопутствующей патологии с ПРЛ на объемах гиппокампа и миндалины была объектом исследования, но результаты все еще остаются спорными. Schmahl и его коллеги [38] сравнили две группы женщин-пациенток с ПРЛ, не принимавших лекарственные препараты, с сопутствующим посттравматическим стрессовым расстройством и без него, и 25 женщин контрольной группы. Они обнаружили снижение объемов гиппокампа только у пациентов с ПРЛ и сопутствующим посттравматическим стрессовым расстройством, но не у пациентов с ПРЛ без посттравматического стрессового расстройства в анамнезе по сравнению с контрольной группой.Аналогичным образом Kreisel и соавторы [70] детально исследовали структурные объемы гиппокампа, сравнивая 39 пациентов с БЛД с 39 подобранными контрольными группами, и, хотя не было обнаружено различий в объеме между двумя группами, пациенты с пожизненным анамнезом ПТСР имели меньший объем гиппокампа ( −10,5%), чем у пациентов без коморбидного посттравматического стрессового расстройства. Боен с соавторами [71] исследовали объемы Cornu Ammonis (CA) и Dentate Gyrus (DG), двух структур гиппокампа, склонных к морфологическим изменениям [72] в ответ на неблагоприятные изменения окружающей среды в группе из 18 женщин с ПРЛ и 21 контролирует.Авторы обнаружили, что уязвимые к стрессу подполя DG-CA4 и CA2–3 были значительно меньше у пациентов с БЛД, чем в контрольной группе. Однако они не выявили какой-либо значительной связи между объемами подполей и зарегистрированной детской травмой.

    В другом интересном исследовании Kuhlmann с соавторами [73] изучали изменения в сером веществе центральных структур, регулирующих стресс, включая гиппокамп, миндалину, переднюю поясную кору и гипоталамус, у пациенток с ПРЛ и контрольной группы.Авторы также исследовали, был ли объем серого вещества этих четырех структур мозга связан с детской травмой, сообщая, что у пациентов с ПРЛ объем гиппокампа был ниже, чем у здоровых людей в контрольной группе, но более высокий объем в гипоталамусе. Интересно, что объем гипоталамуса положительно коррелировал с историей травм у пациентов с ПРЛ.

    Два недавних метаанализа [37, 63] оценили, может ли величина уменьшения объема гиппокампа и миндалины быть связана с факторами состояния болезни и психическими расстройствами (т.е.е. ПТСР), который часто сочетается с ПРЛ. В метаанализ Родригеса авторы включили 7 статей с общим числом 124 пациентов и 147 контрольных. Они показали, что как левая, так и правая стороны объема гиппокампа были уменьшены у пациентов с ПРЛ с посттравматическим стрессовым расстройством по сравнению с контрольной группой. Объем левого гиппокампа не был значительно меньше у пациентов с ПРЛ без посттравматического стрессового расстройства по сравнению со здоровым контролем, а объем правого гиппокампа был уменьшен у пациентов с ПРЛ без сопутствующего посттравматического стрессового расстройства, но в меньшей степени, чем у пациентов с ПРЛ с посттравматическим стрессовым расстройством.Напротив, результаты, представленные метаанализом Руокко [37], который включал 11 исследований с общим числом 205 пациентов с БЛД и 222 контрольных, показали, что двустороннее уменьшение объема миндалины и гиппокампа не связано с сопутствующим большим депрессивным расстройством (БДР). , Посттравматическое стрессовое расстройство или расстройства, связанные с употреблением психоактивных веществ.

    В совокупности все эти исследования показывают, что основные области мозга, участвующие в ПРЛ, связаны со стрессом, и подчеркивают важность классификации подгрупп пациентов с ПРЛ, особенно с учетом наличия коморбидности с посттравматическим стрессовым расстройством или детского анамнеза. травма.Тем не менее, связь между уменьшением объема и степенью, в которой детская травма может быть причиной этих изменений, остается неясной.

    Изменения эндогенной опиодной системы в областях мозга, участвующих в реакции на стресс

    Несмотря на большое количество данных, относящихся к объемным и морфологическим изменениям в областях мозга, связанных с конкретными клиническими особенностями ПРЛ, было проведено не так много нейровизуализационных исследований для изучения роли эндогенная опиоидная система при ПРЛ.Как упоминалось ранее, Prossin и соавторы [61] измерили in vivo доступность μ-опиоидных рецепторов (потенциал несмещаемого связывания (BPND)) в группе пациентов с ПРЛ, не получавших лекарств, по сравнению с женщинами контрольной группы с помощью ПЭТ и селективный радиоактивный индикатор [11C] карфентанил на исходном уровне и во время устойчивых состояний печали. Пациенты имели более высокий региональный μ-опиоидный BPND, чем контрольная группа на исходном уровне (нейтральное состояние) в левом прилежащем ядре, гипоталамусе и правом гиппокампе / парагиппокампе по сравнению с субъектами сравнения, что свидетельствует об активации эндогенной опиоидной системы.Как предполагают авторы, различия между пациентами с ПРЛ и контрольной группой в исходных концентрациях µ-опиоидных рецепторов in vivo и в ответе эндогенной опиоидной системы на отрицательный эмоциональный вызов могут быть связаны с некоторыми клиническими характеристиками пациентов с ПРЛ. Эти результаты показывают изменения в функции эндогенной опиоидной системы и μ-опиоидных рецепторов в областях мозга, участвующих в обработке эмоций и стресса, принятии решений, а также регуляции боли и нейроэндокринной системы, которые также связаны с ПРЛ.

    ПРЛ и эпигенетические механизмы

    Было высказано предположение, что влияние факторов окружающей среды, таких как детская травма, происходит через эпигенетические механизмы, которые могут лежать в основе уязвимости, связанной с генами и окружающей средой, для развития связанных со стрессом расстройств [74], включая ПРЛ при детской травме. анамнез встречается у большинства пациентов (от 30 до 90%) [7, 9].

    Среди наиболее изученных эпигенетических механизмов можно выделить: (i) метилирование ДНК, которое происходит в динуклеотидах CG (CpG) и может влиять на пространственную структуру ДНК и связывание или репрессию конкретных ДНК-связывающих белков с ДНК [ 75], (ii) модификации гистонов, которые влияют на конденсацию ДНК вокруг гистоновых белков и регулируют доступность функциональных областей для факторов транскрипции [76] и (iii) посттранскрипционную регуляцию некодирующими РНК, такими как микроРНК (miRNAs). ) [77].

    Все эти эпигенетические процессы и, в частности, изменения метилирования ДНК широко исследовались в контексте долгосрочных негативных эффектов стрессовых событий в раннем возрасте. У нечеловеческих приматов и у грызунов несколько парадигм стресса в раннем возрасте, включая разлучение с матерью или пренатальный стресс, были связаны с эпигенетическими изменениями через метилирование ДНК [78, 79]. Например, самки, не подвергавшиеся стрессу во время беременности, показали повышенную частоту облизывания и ухода за шерстью в первую неделю жизни щенков, что было связано с изменениями метилирования ДНК в промоторе генов, таких как ген глюкокортикоидного рецептора (NR3C1), известный как участвовать в поведении и развитии нервной системы.

    Гипотеза состоит в том, что качество материнской помощи, пострадавшее от стресса или депрессии во время беременности и в послеродовой период [80, 81], может повлиять через эпигенетические механизмы на экспрессию генов и поведенческие черты, которые сохраняются на протяжении всей жизни [78].

    Недавно McGowan и его коллеги [79] исследовали метилирование ДНК, ацетилирование гистонов и экспрессию генов в области 7 миллионов пар оснований хромосомы 18, содержащей ген NR3C1, в гиппокампе потомства взрослых крыс, матери которых различались по частоте материнской заботы. .Авторы обнаружили, что у взрослого потомства с высоким уровнем материнской заботы по сравнению с низким уровнем материнской заботы был выявлен ряд областей, охватывающих ген NR3C1, которые были дифференциально метилированы и ацетилированы, что подчеркивает идею о том, что эпигенетические изменения в контексте стресса в раннем возрасте включают изменения в генах. сети, а не в одном или нескольких генах.

    Аналогичным образом, исследования на людях показали результаты, аналогичные результатам, обнаруженным на грызунах, включая повышенные уровни метилирования в промоторной области NR3C1 у субъектов, которые сообщили о нежелательных явлениях в раннем возрасте в анамнезе [82,83,84].Например, в другом интересном исследовании McGowan и соавторы [82] обнаружили, что у людей уровни метилирования цитозина промотора NR3C1 были значительно увеличены в посмертном гиппокампе, полученном от жертв самоубийства, подвергавшихся жестокому обращению в детстве, по сравнению с уровнями от жертв самоубийства. без жестокого обращения в детстве или с контрольными образцами. Также были выявлены пониженные уровни мРНК NR3C1, что свидетельствует о влиянии жестокого обращения в детстве на статус метилирования NR3C1 и экспрессию генов независимо от суицида.

    Несколько эпигенетических исследований было также проведено с участием контрольных субъектов, у которых в анамнезе была детская травма, по сравнению с теми, у кого не было детской травмы. В этом контексте Suderman и его коллеги [85] продемонстрировали, используя подход метилирования промоторной ДНК по всему геному, связанное со злоупотреблением гиперметилирование в 31 miRNAs в выборке контрольных взрослых мужчин, подвергшихся жестокому обращению в детстве. Состояние гиперметилирования для 6 из этих miRNAs согласуется со статусом гипометилирования их генов-мишеней.

    Пониженные уровни метилирования гена FKBP5 в областях, содержащих функциональные глюкокортикоид-чувствительные элементы (GRE), также были обнаружены в крови контрольных лиц, подвергшихся жестокому обращению в детстве, по сравнению с субъектами без травм в анамнезе [86]. Это деметилирование было связано с усилением стресс-зависимой транскрипции генов, за которым следовало долгосрочное нарушение регуляции системы гормонов стресса и глобальное влияние на функцию иммунных клеток и областей мозга, связанных с регуляцией стресса.Т.о., по мнению авторов, изменения в уровнях метилирования FKBP5 могут увеличивать дифференциальную чувствительность FKBP5 к активации GR, которая может оставаться стабильной с течением времени. Более того, Лабонте и его коллеги [87] провели полногеномное исследование метилирования промоторов в гиппокампе людей с историей жестокого обращения в детстве и контрольных субъектов. Затем профили метилирования сравнивали с соответствующими профилями экспрессии генов по всему геному. Среди всех дифференциально метилированных промоторов 248 показали гиперметилирование, тогда как 114 продемонстрировали гипометилирование, а гены, участвующие в клеточной / нейрональной пластичности, были среди наиболее значимо дифференциально метилированных.

    Несмотря на то, что вклад метилирования ДНК широко исследовался в связи с детской травмой в контексте патологий, связанных со стрессом, исследования возможного участия эпигенетических механизмов в уязвимости к БЛД проводятся только при их рождении. Действительно, доступно лишь несколько исследований. В частности, Мартин-Бланко и его коллеги исследовали связь между статусом метилирования NR3C1, историей детской травмы и клинической тяжестью в образцах крови субъектов с ПРЛ, показав связь между метилированием NR3C1 и детской травмой в форме физического насилия и тенденция к значимости эмоционального пренебрежения [88].Что касается метилирования NR3C1 и клинической тяжести, авторы также обнаружили значительную связь с самоповреждающим поведением и предыдущими госпитализациями. Все эти данные подтверждают гипотезу о том, что изменения в метилировании NR3C1 могут происходить в раннем возрасте как следствие стрессового воздействия и могут сохраняться до зрелого возраста, когда субъекты с более высокими уровнями метилирования NR3C1 также являются лицами с повышенной уязвимостью к развитию БЛД.

    Было обнаружено, что помимо изменений метилирования ДНК в NR3C1, гипо- или гиперметилирование в других генах играет ключевую роль в опосредовании воздействия стресса в раннем возрасте на развитие связанных со стрессом расстройств, включая БЛД [89,90 , 91,92].Например, в исследовании, проведенном Дамманном и его коллегами [89], паттерн метилирования ДНК 14 генов, выбранных из-за того, что ранее был связан с ПРЛ и другими психическими расстройствами, (COMT, переносчик дофамина 1 (DAT1), рецептор гамма-аминомасляной кислоты типа A Alpha1 Субъединица (GABRA1), субъединица G-белка бета 3 (GNB3), глутаматный ионотропный рецептор, субъединица 2B типа NMDA (GRIN2B), 5-гидрокситриптаминовый рецептор 1B (HTR1B), 5-гидрокситриптаминовый рецептор 2A (HTR2A), серотонный переносчик 1 (HTR2A) ), Моноаминоксидаза A (MAOA), моноаминоксидаза B (MAOB), синтаза оксида азота 1 (NOS1), NR3C1, триптофангидроксилаза 1 (TPh2) и тирозингидроксилаза (TH)), были проанализированы в цельной крови пациентов с ПРЛ и контролирует.Увеличение уровней метилирования HTR2A, NR3C1, MAOA, MAOB и COMT наблюдалось у пациентов с БЛД по сравнению с контрольной группой, что позволяет предположить, что повышенное метилирование сайтов CpG в этих генах может вносить вклад в этиопатогенез БЛД. Недавно Перроуд и его коллеги [91] исследовали роль детской травмы на статус метилирования рецептора серотонина 3A (5-HT 3A R), включая несколько CpG, расположенных внутри или выше этого гена. Они проанализировали его связь с клиническими исходами тяжести, а также с функциональным генетическим SNP (rs1062613) в пределах 5-HT 3A R у взрослых пациентов с биполярным расстройством, ПРЛ и синдромом дефицита внимания с гиперактивностью (СДВГ).Результаты показали, что дифференциальный статус метилирования 5-HT 3A R зависел от истории жестокого обращения в детстве и клинической тяжести психического расстройства; эта связь не была конкретно ограничена одним конкретным психическим расстройством, исследованным авторами, но была обнаружена у пациентов, которые сообщили о более высоких показателях тяжести жестокого обращения в детстве, в основном представленных пациентами с ПРЛ. В частности, физическое насилие в детстве было связано с более высокими уровнями метилирования 5-HT 3A R, тогда как эмоциональное пренебрежение в детстве обратно коррелировало с уровнями метилирования CpG1 I.Как предполагают авторы, эти результаты подчеркивают необходимость поиска в анамнезе случаев жестокого обращения в детстве у пациентов, страдающих психическими расстройствами, поскольку эти события могут быть связаны с наихудшими отрицательными исходами. Более того, авт. Обнаружили модуляцию статуса метилирования 5HT 3A R с помощью rs1062613 в CpG2 III, где пациенты, несущие генотип CC риска, обнаруживают самые высокие уровни метилирования в CpG2 III. Поскольку аллель C также был связан с более низкими уровнями экспрессии 5HT 3A R, авторы предположили, что повышенное метилирование из-за жестокого обращения с детьми может привести к дальнейшему снижению экспрессии мРНК 5HT 3A R.

    Стремясь идентифицировать новые гены, которые могут проявлять аберрантную частоту метилирования ДНК у пациентов с ПРЛ, Тешлер и его сотрудники [93] выполнили анализ метилирования по всему геному в крови женщин-пациентов с ПРЛ и женщин контрольной группы. Авторы сообщили о повышенных уровнях метилирования нескольких генов, включая нейрональные адаптерные белки (член 2 семейства A, связывающий белок-предшественник амилоида бета (APBA2) и член семейства A, связывающий белок-предшественник бета-амилоида (APBA3)), факторы транскрипции с цинковыми пальцами (GATA Binding). Белок 4 (GATA4)), ген потенциалзависимого калиевого канала (Подсемейство Q-член 1 (KCNQ1)), факторы обмена гуаниновых нуклеотидов (прото-онкоген MCF-2 (MCF2)), молекулы адгезии (Ninjurin 2 ( NINJ2)) и рецепторов, связанных с G-белком (рецептор, связанный с следами аминов 5 (TAAR5)) в образцах БЛД по сравнению с контролями.Аналогичным образом, используя метод метилирования всего генома, Прадос и его коллеги [94] проанализировали глобальный статус метилирования ДНК в лейкоцитах периферической крови пациентов с БЛД с историей неблагоприятных исходов в детстве, а также у пациентов с БДР, характеризующихся низким уровнем жестокого обращения в детстве. . В отличие от Тешлера [93], который использовал контрольных субъектов в качестве контрольной группы, в этом исследовании авторы использовали субъектов с БДР, большинство из которых пытались покончить жизнь самоубийством, таким образом контролируя не только БДР, но и самоубийство в анамнезе.Авторы также оценили возможные корреляции между признаками метилирования и тяжестью жестокого обращения в детстве. Данные показали, что несколько CpG внутри или рядом с генами, участвующими в воспалительных процессах (рецептор интерлейкина 17 A (IL17RA)), регуляции экспрессии генов (miR124-3), возбудимости нейронов и развитии / поддержании нервной системы (подсемейство калиевых напряженно-управляемых каналов Q Member 2 (KCNQ2)) были по-разному метилированы либо при ПРЛ по сравнению с БДР, либо в зависимости от тяжести жестокого обращения в детстве.

    В более позднем исследовании Teschler и его сотрудники [95] проанализировали также паттерны метилирования ДНК гена рибосомной РНК (промоторная область рДНК и 5'-внешний транскрибируемый спейсер / 5'ETS) и промотор богатого пролином мембранного якоря. 1 ген (PRIMA1) в образцах периферической крови пациенток с БЛД и контрольной группы. Авторы выявили значительное аберрантное метилирование рДНК и PRIMA1 в группе пациентов с БЛД. В частности, среднее метилирование 6 сайтов CpG в промоторе PRIMA1 было 1.В 6 раз выше у пациентов с БЛД по сравнению с контрольной группой. Напротив, уровни метилирования промоторной области рДНК и 5'ETS были значительно ниже (0,9 раза) у пациентов с БЛД по сравнению с контрольной группой. Более того, снижение уровней метилирования было обнаружено для девяти CpG, расположенных в области промотора рДНК, и для 4 CpG в области 5'ETS в периферической крови пациентов по сравнению с контролем. Эти результаты предполагают, что аберрантное метилирование рДНК и PRIMA1 может быть связано с патогенезом БЛД.

    В совокупности все эти исследования показывают сложное взаимодействие между ПРЛ, стрессовыми невзгодами в раннем возрасте и эпигенетическими признаками.

    БЛД и нейропластичность (роль BDNF)

    Нейропластичность относится к связанным с мозгом механизмам, связанным со способностью мозга воспринимать, адаптироваться и реагировать на различные внутренние и внешние раздражители [96, 97], включая стресс.

    Воздействие острых стрессовых ситуаций может вызвать ряд полезных и защитных эффектов для организма, который реагирует почти на любые внезапные неожиданные события высвобождением химических медиаторов - i.е. катехоламины, которые увеличивают частоту сердечных сокращений и артериальное давление - и помогают человеку справиться с ситуацией [20, 98,99,100,101]. Однако хроническое воздействие стресса и, следовательно, хроническое воздействие глюкокортикоидов может иметь негативные и стойкие последствия для организма, включая измененный метаболизм, измененный иммунитет, усиление воспаления, когнитивные нарушения, а также повышенную уязвимость к психическим расстройствам и таким заболеваниям, как как сердечно-сосудистые заболевания, нарушения обмена веществ и рак [102, 103].

    Нейротрофические факторы, и в частности нейротрофический нейротрофический фактор, производный от мозга (BDNF), были идентифицированы как ключевые медиаторы стресса на нейрональные связи, дендритное разветвление, синаптическая пластичность и нейрогенез [104,105,106,107]. Поскольку BDNF играет решающую роль в развитии и пластичности мозга, он также широко исследовался при некоторых психических заболеваниях, включая БЛД [108].

    Например, Кенигсберг и его коллеги [109] обнаружили снижение изофермента протеинкиназы C (PKC), который является молекулой, находящейся ниже по течению от активации BDNF, и уровней белка BDNF в крови пациентов с ПРЛ, что свидетельствует об изменении передачи сигналов BDNF. и, как следствие, механизмов, связанных с нейропластичностью, при ПРЛ.В другом исследовании Tadic и соавторы [49] исследовали связь между BPD и генетическими вариантами в генах HTR1B и BDNF. Хотя данные не показали значительных различий в распределении генотипов или гаплотипов для вариантов HTR1B и BDNF между пациентами с БЛД и контрольной группой, анализ логистической регрессии выявил связь между вариантом HTR1B A-161 и функциональным аллелем BDNF 196A при БЛД.

    Важно отметить, что несколько результатов также документально подтвердили эпигенетические модификации гена BDNF у пациентов с ПРЛ , , предполагая, что жестокое обращение в детстве с пациентами с ПРЛ может вызывать долгосрочные эпигенетические изменения генов, критически важных для функций мозга и развития нервной системы, включая BDNF, и что эти изменения могут способствовать повышению уязвимости к развитию патологии ПРЛ.В связи с этим Perroud с соавторами [90] измерили процент метилирования экзонов I и IV BDNF CpG, а также уровни белка BDNF в плазме у субъектов с БЛД и контрольной группы. Авторы сообщили о значительно более высоком статусе метилирования в обеих областях CpG у пациентов, чем в контрольной группе, при этом количество травм в детстве, связанных с высокими уровнями метилирования BDNF. Более того, у пациентов с БЛД уровень белка плазмы BDNF был значительно выше, чем у контрольной группы, но это увеличение не было связано с изменениями статуса метилирования BDNF.Совсем недавно Thaler и соавторы [92] проанализировали паттерны метилирования ДНК в промоторной области гена BDNF у женщин с нервной булимией и с историей ПРЛ и / или травм. Они сообщили, что нервная булимия сама по себе связана с гиперметилированием в сайтах промоторной области BDNF. Это было особенно очевидно при одновременном проявлении жестокого обращения в детстве или ПРЛ.

    В целом, эти исследования подтверждают гипотезу о том, что детская травма может быть связана с изменениями эпигенетической сигнатуры BDNF, что, в свою очередь, может способствовать изменению когнитивных функций у пациентов с ПРЛ.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    Кандидат PTA Типичная концентрация PM2,5 110 (мкг м − 3) Тип исследования
    Острый Субхронический Хронический
    Северо-восток США Северо-восток США x
    Северо-восток Канады 9 x
    Юго-восток США 13 x x 68 x x
    Италия 17 x x
    Израиль 20 x

    x

    Тайвань 26 x 910 83
    Чили 27 x x
    Южная Африка 46 x
    0
    0 Эфиопия x
    Китай 80 x x
    Индия 118 x 9105

    0 base Миссия MAIA рассчитана на 3 года.Многие эпидемиологические исследования, проведенные по всему миру, выявили связь между острым (ежедневным) воздействием ТЧ и смертностью, госпитализацией и посещениями отделений неотложной помощи с использованием данных за

    <3 лет в густонаселенных регионах. 112 - 115 Неблагоприятные воздействия на пренатальное или неонатальное развитие, например, ограничение внутриутробного развития, преждевременные роды, низкий вес при рождении, врожденные пороки сердца и младенческая смертность, 5 , 116 , 117 были связаны с воздействием ТЧ во время определенных триместров беременности. 118 , 119 Следовательно, исследования исходов родов, ориентированные на эффекты, специфичные для триместра, могут даже использовать данные менее 1 года, если популяция беременных женщин, проживающих в этом районе, достаточно велика. 120 - 122 Долгосрочные исследования хронического воздействия сердечно-сосудистых заболеваний также основывались на данных всего за 2–3 года, а некоторые из них получили статистически значимые результаты за один год. 65 , 123 - 128 Хотя это может показаться удивительным, пространственные структуры PM и порядок ранжирования имеют тенденцию быть довольно стабильными из года в год, и результаты показывают, что предполагаемые воздействия на здоровье в краткосрочной перспективе воздействия согласуются с исследованиями с использованием более длительных периодов воздействия. 65 В этих эпидемиологических исследованиях, нацеленных на хронические последствия для здоровья, обычно используются большие когорты (группы людей, которые подвергались воздействию загрязнителей воздуха разного уровня или состава в течение длительных периодов времени).

    Медицинские исследования с геокодированными объектами с высоким пространственным разрешением (на уровне адресов) позволяют наиболее точно оценить воздействие на здоровье, связанное с воздействием ТЧ. Разрешение MAIA позволяет извлекать PM на сетке 1 км для отбора проб в масштабе района.Хотя сульфат имеет относительно низкую пространственную изменчивость в масштабах от города к региону, 129 нитрат и первичный ОК варьируются в меньших пространственных масштабах. Аэрозоли ЧУ очень неоднородны из-за их образования в результате сжигания автомобильного топлива и сжигания биомассы. 129 , 130 Недавние исследования подчеркивают ценность спутниковых аэрозольных данных на расстоянии 1 км для изучения воздействия на здоровье. 96 , 131 - 133

    4.

    Выводы

    Основываясь на успехе MISR и других спутниковых инструментов в обеспечении наблюдений за аэрозолями, которые внесли свой вклад в многочисленные медицинские исследования, исследование MAIA направлено на дальнейшее развитие этих усилий путем более глубокого изучения влияния различных типов переносимых по воздуху частиц. здоровью человека. Хотя большая часть усилий по разработке связана с проектированием и изготовлением спутникового инструмента, исследование также в значительной степени полагается на наземные мониторы и CTM для создания карт PM, необходимых для выполнения задач миссии.Хотя мониторинг ТЧ в целях регулирования в основном касается абсолютных массовых концентраций частиц, эпидемиологические исследования сосредоточены на ответных мерах, связанных с относительными различиями в воздействии ТЧ окружающей среды. Следовательно, подход к обработке данных MAIA разрабатывается на каждом этапе для устранения систематических ошибок в продуктах PM, начиная с калибровки изображений прибора, проверки продуктов AOD столбца, применения полученных эмпирическим путем GRM для преобразования AOD в PM и использования спутниковые и наземные наблюдения для устранения предвзятости в CTM, что является ключевым элементом стратегии заполнения пробелов.Влияние случайных ошибок смягчается статистическим преимуществом наблюдения за целыми крупными мегаполисами из космоса и получения медицинской информации, связанной с сотнями тысяч и миллионами людей. Благодаря включению эпидемиологов в научную группу, MAIA стала первой спутниковой миссией НАСА, отобранной на конкурсной основе, с приложениями / социальными преимуществами в качестве своей основной цели.

    Раскрытие информации

    Авторы заявляют об отсутствии конфликта интересов.

    Благодарности

    Авторы выражают признательность за участие в исследовании MAIA многопрофильной группы, включая экспертов в области системного проектирования, проектирования и изготовления приборов, управления проектами и ресурсами, систем данных, операций с приборами, дистанционного зондирования аэрозолей и облаков, эпидемиологии и здравоохранение. Особо следует упомянуть наших сотрудников Берта Брунекрифа (Утрехтский университет), Санника Дей (ИИТ Дели), Кембра Хаудшелл (Национальный институт наук об окружающей среде), Джона Лангстаффа (EPA), Пиуса Ли (Национальное управление океанических и атмосферных исследований) и Фуюэна. Yip (Центры по контролю и профилактике заболеваний), а также многие местные сотрудники различных PTA, которые будут помогать в различных аспектах проекта.В этом документе представлен текущий статус расследования MAIA. Решение о внедрении MAIA не будет принято до тех пор, пока НАСА не завершит процесс принятия Закона о национальной экологической политике (NEPA). Это исследование частично проводится в Лаборатории реактивного движения Калифорнийского технологического института по контракту с Национальным управлением по аэронавтике и исследованию космического пространства (НАСА). Данные на рис. 1 были получены из центра данных атмосферного научного центра NASA Langley Research Center.

    Список литературы

    6.

    «Глобальная, региональная и национальная сравнительная оценка 84 поведенческих, экологических, профессиональных и метаболических рисков или групп рисков, 1990–2016 гг .: систематический анализ для исследования глобального бремени болезней 2016», Ланцет, 390 1345 –1422 (2017). https://doi.org/10.1016/S0140-6736(17)32366-8 LANCAO 0140-6736 Google Scholar

    8.

    A. J. Cohen et al., «Оценки и 25-летние тенденции глобального бремени болезней, связанных с загрязнением атмосферного воздуха: анализ данных исследования глобального бремени болезней 2015 г.», Ланцет, 389 1907 –1918 (2017).https://doi.org/10.1016/S0140-6736(17)30505-6 LANCAO 0140-6736 Google Scholar

    9.

    M. L. Bell et al., «Пространственные и временные изменения химического состава PM2,5 в Соединенных Штатах для исследований воздействия на здоровье», Environ. Перспектива здоровья., 115 989 –995 (2007). https://doi.org/10.1289/ehp.9621 EVHPAZ 0091-6765 Google Scholar

    10.

    «Национальные стандарты качества атмосферного воздуха для твердых частиц; последнее правило " (2013).Google Scholar

    16.

    Справочник по обеспечению качества для систем измерения загрязнения воздуха, (2013). Google Scholar

    19.

    D. L. Crouse et al., «Риск неслучайной и сердечно-сосудистой смертности в связи с долгосрочным воздействием низких концентраций мелких твердых частиц: когортное исследование на национальном уровне в Канаде», Environ. Перспектива здоровья., 120 708 –714 (2012). https://doi.org/10.1289/ehp.1104049 EVHPAZ 0091-6765 Google Scholar

    20.

    Процветание на нашей меняющейся планете: десятилетняя стратегия наблюдения Земли из космоса, The National Academies Press, Вашингтон, округ Колумбия (2018). Google Scholar

    21.

    Дж. В. Мартончик, Д. Дж. Дайнер, Р. А. Кан, «Получение свойств аэрозоля над сушей с использованием наблюдений MISR», Спутниковое дистанционное зондирование аэрозолей над землей, 267 –293 Springer Praxis Books, Берлин, Германия (2009). https://doi.org/10.1007/978-3-540-69397-0 Google Scholar

    25.

    A. van Donkelaar et al., «Использование спутниковых наблюдений для оценки долгосрочного воздействия на глобальные концентрации мелких твердых частиц», Environ. Перспектива здоровья., 123 135 –143 (2016). https://doi.org/10.1289/ehp.1408646 EVHPAZ 0091-6765 Google Scholar

    30.

    H. Chen et al., «Окружающие мелкие твердые частицы и смертность среди выживших после инфаркта миокарда: популяционное когортное исследование», Environ. Перспектива здоровья., 124 (9), 1421 г. –1428 (2016).https://doi.org/10.1289/EHP185 EVHPAZ 0091-6765 Google Scholar

    31.

    H. Chen et al., «Риск развития диабета в связи с длительным воздействием мелких твердых частиц в Онтарио, Канада», Environ. Перспектива здоровья., 121 (7), 804 –810 (2013). https://doi.org/10.1289/ehp.1205958 EVHPAZ 0091-6765 Google Scholar

    32.

    N. L. Fleischer et al., «Загрязнение наружного воздуха, преждевременные роды и низкий вес при рождении: анализ Глобального исследования Всемирной организации здравоохранения по охране материнского и перинатального здоровья», Environ.Перспектива здоровья., 122 425 –430 (2014). https://doi.org/10.1289/ehp.1306837 EVHPAZ 0091-6765 Google Scholar

    33.

    D. J. Diner et al., «Описание прибора для многоуглового спектрорадиометра (MISR) и обзор эксперимента», IEEE Trans. Geosci. Рем. Сенс., 36 1072 –1087 (1998). https://doi.org/10.1109/36.700992 IGRSD2 0196-2892 Google Scholar

    41.

    Калашникова О.В. и др., «Возможность многоугловых дистанционных наблюдений для идентификации и различения типов минеральной пыли: оптические модели и извлечение оптически толстых шлейфов», Дж.Geophys. Res.-Atmos., 110 Д18С14 (2005). https://doi.org/10.1029/2004JD004550 Google Scholar

    43.

    Дж. В. Мартончик и др., «Методы восстановления свойств аэрозолей над сушей и океаном с использованием многоугловой визуализации», IEEE Trans. Geosci. Пульт Сенс., 36 1212 –1227 (1998). https://doi.org/10.1109/36.701027 IGRSD2 0196-2892 Google Scholar

    50.

    Y. Liu et al., «Подтверждение результатов измерений оптической толщины аэрозолей с помощью многоугольного спектрорадиометра (MISR) с использованием наблюдений сети Aerosol Robotic Network (AERONET) над прилегающей территорией Соединенных Штатов», Дж.Geophys. Res.-Atmos., 109 D06205 (2004). https://doi.org/10.1029/2003JD003981 Google Scholar

    51.

    A. van Donkelaar et al., «Глобальные оценки мелких твердых частиц с использованием комбинированного геофизико-статистического метода с использованием информации со спутников, моделей и мониторов», Environ. Sci. Технол., 50 3762 –3772 (2016). https://doi.org/10.1021/acs.est.5b05833 ESTHAG 0013-936X Google Scholar

    52.

    Ю. Лю, Р. Кан и П.Кутракис, «Оценка концентраций компонентов PM2,5 и распределения по размерам с использованием спутниковой оптической толщины фракционного аэрозоля: часть 1 - разработка метода», J. Air Waste Manag. Доц., 57 1351 –1359 (2007). https://doi.org/10.3155/1047-3289.57.11.1351 Google Scholar

    59.

    М. Дж. Гарай, О. В. Калашникова и М. А. Булл, «Разработка и оценка продукта оптической глубины аэрозоля MISR с более высоким пространственным разрешением (4,4 км) с использованием данных AERONET-DRAGON», Атмос.Chem. Физ., 17 5095 –5106 (2017). https://doi.org/10.5194/acp-17-5095-2017 ACPTCE 1680-7324 Google Scholar

    60.

    М. Франклин, О. В. Калашникова и М. Дж. Гарай, «Концентрации твердых частиц с разрешенным размером, полученные с помощью многоугольного спектрорадиометра с фракционированным размером частиц с разрешением 4,4 км и оптической толщиной аэрозоля над Южной Калифорнией», Remote Sens. Environ., 196 312 –323 (2017). https://doi.org/10.1016/j.rse.2017.05.002 Google Scholar

    65.

    B. Ostro et al., «Долгосрочное воздействие компонентов загрязнения воздуха мелкими частицами и смертность: результаты Калифорнийского исследования учителей», Environ. Перспектива здоровья, 118 363 –369 (2010). https://doi.org/10.1289/ehp.0